Incidental Mutation 'R3013:Hip1'
ID257563
Institutional Source Beutler Lab
Gene Symbol Hip1
Ensembl Gene ENSMUSG00000039959
Gene Namehuntingtin interacting protein 1
SynonymsHIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik
MMRRC Submission 040534-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R3013 (G1)
Quality Score162
Status Validated
Chromosome5
Chromosomal Location135406531-135545120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135435039 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 37 (E37V)
Ref Sequence ENSEMBL: ENSMUSP00000144086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643] [ENSMUST00000212301]
Predicted Effect probably benign
Transcript: ENSMUST00000060311
AA Change: E448V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: E448V

DomainStartEndE-ValueType
ENTH 38 160 9.98e-41 SMART
PDB:3I00|B 361 480 9e-57 PDB
Pfam:HIP1_clath_bdg 482 572 2.1e-27 PFAM
low complexity region 649 658 N/A INTRINSIC
low complexity region 780 796 N/A INTRINSIC
ILWEQ 806 1004 9.05e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202236
Predicted Effect possibly damaging
Transcript: ENSMUST00000202643
AA Change: E37V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959
AA Change: E37V

DomainStartEndE-ValueType
PDB:2QA7|D 1 70 9e-34 PDB
Pfam:HIP1_clath_bdg 71 161 4.4e-24 PFAM
low complexity region 238 247 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
ILWEQ 395 593 5.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212301
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C T 8: 123,484,677 R126W probably benign Het
Alg10b T A 15: 90,227,556 I201N possibly damaging Het
Arid2 T C 15: 96,361,936 S326P probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bpifb5 T C 2: 154,228,855 S189P possibly damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Ccdc57 A G 11: 120,861,199 V852A probably benign Het
Ces1e G A 8: 93,203,287 S455L probably benign Het
Cyp4f14 T C 17: 32,909,165 K292R probably benign Het
Dnah7b T C 1: 46,188,687 probably null Het
Eml5 T C 12: 98,880,808 probably null Het
Gm13119 T A 4: 144,362,455 D114E probably damaging Het
Gtf2i T C 5: 134,295,504 probably benign Het
Hspbp1 G T 7: 4,663,484 T299K probably benign Het
Lrpprc T C 17: 84,767,069 D470G probably benign Het
Mkx A T 18: 6,936,929 I334N probably damaging Het
Obscn A T 11: 59,060,918 L4003Q probably damaging Het
Pcnx2 C A 8: 125,887,770 C314F probably benign Het
Prr5l A G 2: 101,734,705 F162S probably damaging Het
Rbfox2 T C 15: 77,132,920 T17A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A T 2: 112,640,281 F4610L probably damaging Het
Scp2 T A 4: 108,071,357 R379W probably damaging Het
Serpina3j A G 12: 104,319,707 T374A probably damaging Het
Smad4 T C 18: 73,648,904 Y429C probably damaging Het
Ttn T C 2: 76,734,681 T28401A probably damaging Het
Wdr49 A G 3: 75,450,847 I260T probably damaging Het
Xirp1 T C 9: 120,019,785 T11A probably benign Het
Zfp235 A G 7: 24,140,732 D262G probably damaging Het
Other mutations in Hip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Hip1 APN 5 135449822 missense probably damaging 1.00
IGL00418:Hip1 APN 5 135426346 missense probably damaging 1.00
IGL01744:Hip1 APN 5 135545063 utr 5 prime probably benign
IGL02494:Hip1 APN 5 135444791 nonsense probably null
IGL02749:Hip1 APN 5 135444751 missense probably benign 0.00
IGL03219:Hip1 APN 5 135457050 missense probably benign 0.16
IGL03328:Hip1 APN 5 135424874 missense probably damaging 1.00
BB010:Hip1 UTSW 5 135460456 missense probably damaging 0.98
BB020:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0336:Hip1 UTSW 5 135428613 missense probably benign 0.39
R0410:Hip1 UTSW 5 135458155 missense probably damaging 1.00
R1454:Hip1 UTSW 5 135438632 missense probably benign
R1530:Hip1 UTSW 5 135444780 missense probably damaging 1.00
R1848:Hip1 UTSW 5 135435141 splice site probably null
R2201:Hip1 UTSW 5 135431730 missense probably benign
R2246:Hip1 UTSW 5 135452844 missense probably damaging 1.00
R2276:Hip1 UTSW 5 135457046 missense probably damaging 1.00
R2353:Hip1 UTSW 5 135412712 missense probably damaging 1.00
R3413:Hip1 UTSW 5 135422172 missense probably damaging 1.00
R3939:Hip1 UTSW 5 135428764 missense probably benign 0.14
R4153:Hip1 UTSW 5 135412706 missense probably damaging 1.00
R4839:Hip1 UTSW 5 135426318 splice site probably null
R5059:Hip1 UTSW 5 135449821 missense probably damaging 1.00
R5171:Hip1 UTSW 5 135440302 missense probably damaging 1.00
R5189:Hip1 UTSW 5 135434293 missense probably damaging 1.00
R5358:Hip1 UTSW 5 135436398 missense probably benign 0.22
R5642:Hip1 UTSW 5 135433085 nonsense probably null
R5646:Hip1 UTSW 5 135428741 missense probably damaging 0.98
R5831:Hip1 UTSW 5 135411263 missense probably benign 0.00
R5908:Hip1 UTSW 5 135424863 critical splice donor site probably null
R6484:Hip1 UTSW 5 135440129 missense probably damaging 1.00
R6535:Hip1 UTSW 5 135428497 splice site probably null
R6557:Hip1 UTSW 5 135428719 missense possibly damaging 0.67
R7459:Hip1 UTSW 5 135414297 missense probably damaging 1.00
R7589:Hip1 UTSW 5 135414311 missense probably benign
R7677:Hip1 UTSW 5 135430317 missense probably benign
R7933:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R8267:Hip1 UTSW 5 135428613 missense probably benign 0.39
Z1177:Hip1 UTSW 5 135428606 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATCAATGTGTCCTTGGC -3'
(R):5'- GTGATAAGTCATTTCCTGTCCTGC -3'

Sequencing Primer
(F):5'- CAATGTGTCCTTGGCTCAGCAG -3'
(R):5'- CCTGGCAGTAGTGAGCTTCTC -3'
Posted On2015-01-11