Incidental Mutation 'R3013:Smad4'
ID257582
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 040534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3013 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73648904 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 429 (Y429C)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025393
AA Change: Y429C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: Y429C

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114939
AA Change: Y429C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: Y429C

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147315
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l1 C T 8: 123,484,677 R126W probably benign Het
Alg10b T A 15: 90,227,556 I201N possibly damaging Het
Arid2 T C 15: 96,361,936 S326P probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bpifb5 T C 2: 154,228,855 S189P possibly damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Ccdc57 A G 11: 120,861,199 V852A probably benign Het
Ces1e G A 8: 93,203,287 S455L probably benign Het
Cyp4f14 T C 17: 32,909,165 K292R probably benign Het
Dnah7b T C 1: 46,188,687 probably null Het
Eml5 T C 12: 98,880,808 probably null Het
Gm13119 T A 4: 144,362,455 D114E probably damaging Het
Gtf2i T C 5: 134,295,504 probably benign Het
Hip1 T A 5: 135,435,039 E37V possibly damaging Het
Hspbp1 G T 7: 4,663,484 T299K probably benign Het
Lrpprc T C 17: 84,767,069 D470G probably benign Het
Mkx A T 18: 6,936,929 I334N probably damaging Het
Obscn A T 11: 59,060,918 L4003Q probably damaging Het
Pcnx2 C A 8: 125,887,770 C314F probably benign Het
Prr5l A G 2: 101,734,705 F162S probably damaging Het
Rbfox2 T C 15: 77,132,920 T17A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 A T 2: 112,640,281 F4610L probably damaging Het
Scp2 T A 4: 108,071,357 R379W probably damaging Het
Serpina3j A G 12: 104,319,707 T374A probably damaging Het
Ttn T C 2: 76,734,681 T28401A probably damaging Het
Wdr49 A G 3: 75,450,847 I260T probably damaging Het
Xirp1 T C 9: 120,019,785 T11A probably benign Het
Zfp235 A G 7: 24,140,732 D262G probably damaging Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1163:Smad4 UTSW 18 73648907 missense probably damaging 0.99
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
R7450:Smad4 UTSW 18 73677853 missense probably damaging 1.00
R7524:Smad4 UTSW 18 73675871 missense probably damaging 1.00
R8001:Smad4 UTSW 18 73641810 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGCTCACAATTCTCCTGC -3'
(R):5'- ATGCACCTGAACTGAAACCTG -3'

Sequencing Primer
(F):5'- GCCGTCTGTTGAATGTGCCC -3'
(R):5'- GCACCTGAACTGAAACCTGTTATAAC -3'
Posted On2015-01-11