Incidental Mutation 'R3014:Angpt4'
ID257584
Institutional Source Beutler Lab
Gene Symbol Angpt4
Ensembl Gene ENSMUSG00000027460
Gene Nameangiopoietin 4
Synonyms
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location151911210-151945337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 151929597 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 278 (V278L)
Ref Sequence ENSEMBL: ENSMUSP00000028955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028955]
Predicted Effect probably benign
Transcript: ENSMUST00000028955
AA Change: V278L

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028955
Gene: ENSMUSG00000027460
AA Change: V278L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
coiled coil region 181 239 N/A INTRINSIC
low complexity region 253 267 N/A INTRINSIC
FBG 292 507 2.23e-98 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the angiopoietin family of secreted growth factors comprising Angiopoietins-1, -2, and -3, all of which bind the TEK Receptor Tyrosine Kinase. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is involved in survival and migration of endothelial cells and regulates vascular remodeling and maintenance of vascular integrity. Angiopoietin/TEK Receptor Tyrosine Kinase signaling is also required for lymphangiogenesis. Family members bind TEK Receptor Tyrosine Kinase as multimeric clusters but their oligomerization properties differ from one another and this is thought to provide a mechanistic basis for their distinct physiologic roles. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Angpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Angpt4 APN 2 151911471 missense probably damaging 0.99
IGL03107:Angpt4 APN 2 151943422 missense probably benign 0.08
IGL03343:Angpt4 APN 2 151936703 missense probably damaging 1.00
R0034:Angpt4 UTSW 2 151929391 missense probably benign 0.44
R0709:Angpt4 UTSW 2 151934514 missense possibly damaging 0.46
R0764:Angpt4 UTSW 2 151911284 start gained probably benign
R0853:Angpt4 UTSW 2 151938927 missense probably damaging 1.00
R1796:Angpt4 UTSW 2 151938989 missense probably damaging 1.00
R2091:Angpt4 UTSW 2 151936783 splice site probably benign
R2184:Angpt4 UTSW 2 151938954 missense probably damaging 1.00
R2901:Angpt4 UTSW 2 151911339 missense unknown
R4192:Angpt4 UTSW 2 151943318 missense probably benign
R4440:Angpt4 UTSW 2 151944646 missense probably damaging 1.00
R5059:Angpt4 UTSW 2 151934440 missense probably damaging 1.00
R5326:Angpt4 UTSW 2 151925544 critical splice donor site probably null
R6345:Angpt4 UTSW 2 151929434 missense probably benign 0.00
R7232:Angpt4 UTSW 2 151929540 missense possibly damaging 0.63
R7313:Angpt4 UTSW 2 151925406 missense probably benign
R7456:Angpt4 UTSW 2 151939067 missense probably damaging 1.00
R7598:Angpt4 UTSW 2 151925525 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAGGCTCACCCCTATGTGTC -3'
(R):5'- GGCCAGTATAATCACTGTTCATTG -3'

Sequencing Primer
(F):5'- TATGTGTCCACCTGGCAGG -3'
(R):5'- CATTGAGTTTCTCTTTTGCAAATGG -3'
Posted On2015-01-11