Incidental Mutation 'R3014:Gmps'
ID257586
Institutional Source Beutler Lab
Gene Symbol Gmps
Ensembl Gene ENSMUSG00000027823
Gene Nameguanine monophosphate synthetase
SynonymsGm9479
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location63976106-64022579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64015436 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 607 (K607E)
Ref Sequence ENSEMBL: ENSMUSP00000029405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029405
AA Change: K607E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029405
Gene: ENSMUSG00000027823
AA Change: K607E

DomainStartEndE-ValueType
Pfam:GATase 29 210 6.3e-42 PFAM
Pfam:Peptidase_C26 91 192 1.9e-14 PFAM
Pfam:NAD_synthase 219 339 2.8e-10 PFAM
Pfam:Asn_synthase 231 315 3.9e-6 PFAM
Pfam:tRNA_Me_trans 237 318 1.1e-6 PFAM
Pfam:QueC 238 353 5.3e-9 PFAM
Pfam:GMP_synt_C 492 692 1.4e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Gmps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Gmps APN 3 64014367 missense probably benign
IGL01341:Gmps APN 3 64015440 missense probably damaging 1.00
IGL01369:Gmps APN 3 64001592 missense probably benign 0.00
IGL02332:Gmps APN 3 63990569 missense probably benign 0.01
IGL02481:Gmps APN 3 64014352 missense probably damaging 1.00
IGL02483:Gmps APN 3 64014352 missense probably damaging 1.00
IGL03173:Gmps APN 3 63990329 missense probably damaging 0.98
K3955:Gmps UTSW 3 64001533 missense probably damaging 1.00
R0089:Gmps UTSW 3 63998698 missense probably benign 0.20
R0165:Gmps UTSW 3 63993954 missense probably damaging 1.00
R0466:Gmps UTSW 3 63993944 missense probably damaging 0.97
R0940:Gmps UTSW 3 63976322 splice site probably benign
R1686:Gmps UTSW 3 63985654 missense probably damaging 1.00
R1872:Gmps UTSW 3 64001517 missense probably benign 0.15
R1924:Gmps UTSW 3 63998628 missense probably damaging 1.00
R2229:Gmps UTSW 3 64014263 nonsense probably null
R3800:Gmps UTSW 3 63982445 missense possibly damaging 0.48
R4118:Gmps UTSW 3 63980194 missense probably benign 0.00
R4293:Gmps UTSW 3 63990619 missense probably damaging 0.99
R4596:Gmps UTSW 3 63993917 nonsense probably null
R4665:Gmps UTSW 3 64001535 missense probably benign 0.11
R5032:Gmps UTSW 3 63990325 missense probably benign 0.01
R6045:Gmps UTSW 3 63980137 missense probably benign
R6153:Gmps UTSW 3 64001543 missense probably benign 0.00
R6985:Gmps UTSW 3 64015539 missense probably damaging 1.00
R7188:Gmps UTSW 3 64011561 missense probably damaging 0.97
R7523:Gmps UTSW 3 64011666 missense possibly damaging 0.78
R7724:Gmps UTSW 3 63985653 missense possibly damaging 0.85
R7819:Gmps UTSW 3 63985627 missense probably damaging 1.00
R7849:Gmps UTSW 3 64015563 missense probably benign 0.33
R7932:Gmps UTSW 3 64015563 missense probably benign 0.33
X0063:Gmps UTSW 3 63996850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCCACTTTCAACACTGTAGAAG -3'
(R):5'- CAACGTATATCTATCACTGTACCTGG -3'

Sequencing Primer
(F):5'- AGTATTTGAATTCAGTGTGTGACCAG -3'
(R):5'- TCACTGTACCTGGTAATATATAAGGG -3'
Posted On2015-01-11