Incidental Mutation 'R3014:Tas2r107'
ID257596
Institutional Source Beutler Lab
Gene Symbol Tas2r107
Ensembl Gene ENSMUSG00000053389
Gene Nametaste receptor, type 2, member 107
SynonymsT2R4, Tas2r7, mGR06, STC 5-1, mt2r43, T2R07
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location131659118-131660149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131660009 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 26 (Y26H)
Ref Sequence ENSEMBL: ENSMUSP00000067082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065781]
Predicted Effect probably benign
Transcript: ENSMUST00000065781
AA Change: Y26H

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067082
Gene: ENSMUSG00000053389
AA Change: Y26H

DomainStartEndE-ValueType
Pfam:TAS2R 1 297 4e-106 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Tas2r107
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02749:Tas2r107 APN 6 131659954 missense probably damaging 1.00
IGL02751:Tas2r107 APN 6 131659484 missense probably damaging 1.00
IGL02868:Tas2r107 APN 6 131659286 missense probably benign 0.11
IGL02943:Tas2r107 APN 6 131659406 missense probably damaging 0.99
R1564:Tas2r107 UTSW 6 131659822 missense probably damaging 0.96
R1905:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1906:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R1907:Tas2r107 UTSW 6 131659988 missense probably benign 0.20
R2185:Tas2r107 UTSW 6 131659603 missense probably damaging 0.98
R3824:Tas2r107 UTSW 6 131659330 missense probably benign 0.00
R4465:Tas2r107 UTSW 6 131660009 missense probably benign 0.30
R5058:Tas2r107 UTSW 6 131659742 missense probably damaging 1.00
R5646:Tas2r107 UTSW 6 131659708 missense probably benign 0.02
R5975:Tas2r107 UTSW 6 131659780 missense probably benign 0.02
R6008:Tas2r107 UTSW 6 131659912 missense possibly damaging 0.82
R6144:Tas2r107 UTSW 6 131660003 missense possibly damaging 0.87
R6451:Tas2r107 UTSW 6 131660014 missense possibly damaging 0.81
R6662:Tas2r107 UTSW 6 131659489 missense possibly damaging 0.82
R6702:Tas2r107 UTSW 6 131659384 missense probably benign 0.12
R7032:Tas2r107 UTSW 6 131659190 missense possibly damaging 0.62
R7635:Tas2r107 UTSW 6 131659600 missense possibly damaging 0.92
R8303:Tas2r107 UTSW 6 131659622 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTTATGTTTCCAGAGGTAAGC -3'
(R):5'- AAGAGCACCCATAAAGTTCTGAATC -3'

Sequencing Primer
(F):5'- TCCAGAGGTAAGCATGTGTG -3'
(R):5'- CTGAATCTATCACATGACAATAGGC -3'
Posted On2015-01-11