Incidental Mutation 'R3014:Gria4'
ID257602
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4464294 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 556 (I556T)
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: I556T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: I556T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: I556T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: I556T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: I556T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTCACATCCTTGTTGCATAAAGG -3'
(R):5'- ATCCACTAACTTGTGTATTCCCACG -3'

Sequencing Primer
(F):5'- CTTGTTGCATAAAGGCACCCAGG -3'
(R):5'- TTCTCTTGTAGAAAGCAGAGATTGCC -3'
Posted On2015-01-11