Incidental Mutation 'R3014:Olfr1377'
ID257609
Institutional Source Beutler Lab
Gene Symbol Olfr1377
Ensembl Gene ENSMUSG00000061952
Gene Nameolfactory receptor 1377
SynonymsMOR129-1, GA_x6K02T2QP88-4453480-4452557
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50981967-50986593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50984707 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000151087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075177] [ENSMUST00000213291] [ENSMUST00000216101]
Predicted Effect probably benign
Transcript: ENSMUST00000075177
AA Change: D2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074672
Gene: ENSMUSG00000061952
AA Change: D2G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-51 PFAM
Pfam:7tm_1 41 289 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204581
AA Change: D2G
SMART Domains Protein: ENSMUSP00000144855
Gene: ENSMUSG00000061952
AA Change: D2G

DomainStartEndE-ValueType
Pfam:7tm_4 31 237 5.9e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 227 1.9e-4 PFAM
Pfam:7tm_1 41 235 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213291
AA Change: D2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216101
AA Change: D2G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Olfr1377
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr1377 APN 11 50985003 missense possibly damaging 0.94
R1386:Olfr1377 UTSW 11 50985367 missense probably damaging 0.97
R1486:Olfr1377 UTSW 11 50984781 missense probably benign 0.00
R1613:Olfr1377 UTSW 11 50985218 missense probably damaging 1.00
R2224:Olfr1377 UTSW 11 50985232 missense probably damaging 1.00
R2411:Olfr1377 UTSW 11 50984931 missense probably damaging 0.98
R4080:Olfr1377 UTSW 11 50984856 missense probably damaging 1.00
R4753:Olfr1377 UTSW 11 50985151 missense probably benign 0.05
R4764:Olfr1377 UTSW 11 50984775 missense probably benign 0.00
R4822:Olfr1377 UTSW 11 50985083 nonsense probably null
R4865:Olfr1377 UTSW 11 50985543 missense probably damaging 0.99
R5053:Olfr1377 UTSW 11 50985310 missense probably damaging 1.00
R6054:Olfr1377 UTSW 11 50984804 missense probably benign 0.00
R6368:Olfr1377 UTSW 11 50984786 missense probably benign 0.00
R7589:Olfr1377 UTSW 11 50985030 missense probably damaging 0.98
R7843:Olfr1377 UTSW 11 50985018 missense probably benign 0.06
R7926:Olfr1377 UTSW 11 50985018 missense probably benign 0.06
R8056:Olfr1377 UTSW 11 50985541 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGTTCAGAAGCTGTGGAAG -3'
(R):5'- TCAACACTGGAGAGGTTGGC -3'

Sequencing Primer
(F):5'- TATGGGAAGCATGCTTGC -3'
(R):5'- CCAAGAAGAAGTACATGGGTGTGTG -3'
Posted On2015-01-11