Incidental Mutation 'R3014:Olfr723'
ID257612
Institutional Source Beutler Lab
Gene Symbol Olfr723
Ensembl Gene ENSMUSG00000093825
Gene Nameolfactory receptor 723
SynonymsGA_x6K02T2PMLR-5600424-5599495, MOR247-4, MOR247-3P
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location49928563-49931787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49929032 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 171 (H171Y)
Ref Sequence ENSEMBL: ENSMUSP00000145863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164157] [ENSMUST00000206058]
Predicted Effect probably benign
Transcript: ENSMUST00000164157
AA Change: H171Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129254
Gene: ENSMUSG00000093825
AA Change: H171Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.4e-12 PFAM
Pfam:7tm_1 41 287 4.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206058
AA Change: H171Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gprin1 T A 13: 54,738,475 D662V probably benign Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Olfr723
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Olfr723 APN 14 49929098 missense probably damaging 1.00
IGL02481:Olfr723 APN 14 49928707 missense probably damaging 1.00
IGL03269:Olfr723 APN 14 49928708 missense probably damaging 1.00
IGL03330:Olfr723 APN 14 49929221 missense probably damaging 1.00
R1782:Olfr723 UTSW 14 49928639 missense probably benign
R2061:Olfr723 UTSW 14 49929021 missense possibly damaging 0.78
R4134:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4135:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4212:Olfr723 UTSW 14 49928889 nonsense probably null
R4774:Olfr723 UTSW 14 49929269 missense probably damaging 1.00
R4951:Olfr723 UTSW 14 49929058 nonsense probably null
R4965:Olfr723 UTSW 14 49928897 missense probably benign 0.01
R5254:Olfr723 UTSW 14 49928779 missense probably damaging 0.99
R5306:Olfr723 UTSW 14 49929550 start gained probably benign
R5502:Olfr723 UTSW 14 49929536 missense probably benign
R5799:Olfr723 UTSW 14 49929040 missense probably damaging 1.00
R6062:Olfr723 UTSW 14 49928662 missense probably damaging 1.00
R6072:Olfr723 UTSW 14 49929149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCAGGTGATTTGTGC -3'
(R):5'- GGCCCAGATGTTCTTCATGC -3'

Sequencing Primer
(F):5'- TGCTTTACAATGAGCAGAATGACAG -3'
(R):5'- GTGCTGAAATGACCCTTTTGATAGTC -3'
Posted On2015-01-11