Incidental Mutation 'R3015:Vsig10l'
ID257640
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene NameV-set and immunoglobulin domain containing 10 like
Synonyms
MMRRC Submission 040536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R3015 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43463151-43472019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43467457 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 574 (I574K)
Ref Sequence ENSEMBL: ENSMUSP00000103611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107977
AA Change: I574K

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: I574K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203152
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203769
AA Change: I472K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: I472K

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205247
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,875,462 F76Y probably damaging Het
Adamts9 T C 6: 92,872,932 H380R probably benign Het
Aff3 A T 1: 38,210,568 I486N probably benign Het
Cfap44 A C 16: 44,410,469 D271A probably benign Het
D430042O09Rik T A 7: 125,866,340 H1321Q probably damaging Het
Dbndd2 T A 2: 164,488,350 V34D probably damaging Het
Erc2 T A 14: 28,011,775 probably null Het
Fam159b T A 13: 104,858,391 I83F possibly damaging Het
Fcgbp T C 7: 28,075,413 probably benign Het
Frem3 T C 8: 80,690,773 S2036P probably damaging Het
Golph3l A G 3: 95,591,713 probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ifrd2 G A 9: 107,590,022 G60S probably null Het
Ints9 T A 14: 64,950,278 W3R probably benign Het
Jmjd1c A G 10: 67,157,932 E64G probably damaging Het
Matn3 A C 12: 8,952,217 Q143P probably damaging Het
Myo18a A T 11: 77,859,020 probably benign Het
Nop9 T C 14: 55,751,174 S358P probably benign Het
Pard3b T C 1: 62,344,878 S801P probably damaging Het
Pax2 T C 19: 44,816,024 F268L probably damaging Het
Pik3r1 A G 13: 101,687,263 I538T probably damaging Het
Plekha8 T C 6: 54,622,122 S214P probably benign Het
Ppme1 T C 7: 100,331,877 H352R probably damaging Het
Ppp1r26 A C 2: 28,452,302 D648A probably damaging Het
Prom1 C A 5: 44,034,391 V337F probably damaging Het
Rapgef4 T C 2: 72,198,373 I378T probably damaging Het
Rnf115 T C 3: 96,754,359 S43P probably damaging Het
Rnf216 A G 5: 143,075,725 probably null Het
Scn7a G T 2: 66,699,896 Q702K probably benign Het
Slc2a1 T A 4: 119,132,143 N13K probably damaging Het
Tnr A G 1: 159,888,259 I864V probably benign Het
Tspyl3 A T 2: 153,224,730 M196K probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Umod T C 7: 119,472,540 D326G probably damaging Het
Upf2 A G 2: 5,976,079 D492G unknown Het
Vash1 A G 12: 86,685,420 T126A probably benign Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43465254 missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43466465 missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43464044 missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43463747 missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43463914 missense probably benign 0.02
IGL02636:Vsig10l APN 7 43463578 missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43465242 missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43466464 missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43464869 missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43468101 missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43465455 missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43467442 missense probably damaging 1.00
R0632:Vsig10l UTSW 7 43464137 missense probably damaging 0.97
R1689:Vsig10l UTSW 7 43465368 missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43467468 missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43468761 missense probably benign 0.00
R4024:Vsig10l UTSW 7 43468086 missense probably benign 0.33
R4031:Vsig10l UTSW 7 43465374 missense probably damaging 1.00
R4807:Vsig10l UTSW 7 43463749 missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43465317 nonsense probably null
R5261:Vsig10l UTSW 7 43470850 missense probably damaging 1.00
R5317:Vsig10l UTSW 7 43464823 missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43464823 missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43464151 nonsense probably null
R5842:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6012:Vsig10l UTSW 7 43468015 missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43468972 missense probably benign 0.15
R6309:Vsig10l UTSW 7 43470973 utr 3 prime probably null
R6994:Vsig10l UTSW 7 43465067 missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43463675 missense probably benign
R7397:Vsig10l UTSW 7 43468007 missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43463717 missense probably damaging 0.96
R8086:Vsig10l UTSW 7 43465452 missense possibly damaging 0.92
R8139:Vsig10l UTSW 7 43463729 missense probably benign 0.00
X0028:Vsig10l UTSW 7 43463364 utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43467490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATGACATGTGACCAAAAGCG -3'
(R):5'- CCAGGCTGAAGTTGTTGATGAG -3'

Sequencing Primer
(F):5'- TTTCAGTGGCAGATGCACAC -3'
(R):5'- ATGAGGAGCTTTCGGCCATC -3'
Posted On2015-01-11