Mutagenetix > Incidental Mutation

Incidental Mutation 'R3015:Erc2'

257654

Institutional Source

Beutler Lab

Gene Symbol

Erc2

Ensembl Gene

ENSMUSG00000040640

Gene Name

ELKS/RAB6-interacting/CAST family member 2

Synonyms

ELKS2alpha, D14Ertd171e

MMRRC Submission

040536-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3015 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27622428-28478537 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 28011775 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]

AlphaFold

Q6PH08

Predicted Effect

probably null
Transcript: ENSMUST00000090302

SMART Domains

Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640

Domain	Start	End	E-Value	Type
low complexity region	14	45	N/A	INTRINSIC
low complexity region	121	133	N/A	INTRINSIC
Pfam:Cast	150	907	N/A	PFAM
low complexity region	916	928	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000210135

Predicted Effect

probably null
Transcript: ENSMUST00000210924

Predicted Effect

probably null
Transcript: ENSMUST00000211145

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211627

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 36,875,462	F76Y	probably damaging	Het
Adamts9	T	C	6: 92,872,932	H380R	probably benign	Het
Aff3	A	T	1: 38,210,568	I486N	probably benign	Het
Cfap44	A	C	16: 44,410,469	D271A	probably benign	Het
D430042O09Rik	T	A	7: 125,866,340	H1321Q	probably damaging	Het
Dbndd2	T	A	2: 164,488,350	V34D	probably damaging	Het
Fam159b	T	A	13: 104,858,391	I83F	possibly damaging	Het
Fcgbp	T	C	7: 28,075,413		probably benign	Het
Frem3	T	C	8: 80,690,773	S2036P	probably damaging	Het
Golph3l	A	G	3: 95,591,713		probably benign	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Ifrd2	G	A	9: 107,590,022	G60S	probably null	Het
Ints9	T	A	14: 64,950,278	W3R	probably benign	Het
Jmjd1c	A	G	10: 67,157,932	E64G	probably damaging	Het
Matn3	A	C	12: 8,952,217	Q143P	probably damaging	Het
Myo18a	A	T	11: 77,859,020		probably benign	Het
Nop9	T	C	14: 55,751,174	S358P	probably benign	Het
Pard3b	T	C	1: 62,344,878	S801P	probably damaging	Het
Pax2	T	C	19: 44,816,024	F268L	probably damaging	Het
Pik3r1	A	G	13: 101,687,263	I538T	probably damaging	Het
Plekha8	T	C	6: 54,622,122	S214P	probably benign	Het
Ppme1	T	C	7: 100,331,877	H352R	probably damaging	Het
Ppp1r26	A	C	2: 28,452,302	D648A	probably damaging	Het
Prom1	C	A	5: 44,034,391	V337F	probably damaging	Het
Rapgef4	T	C	2: 72,198,373	I378T	probably damaging	Het
Rnf115	T	C	3: 96,754,359	S43P	probably damaging	Het
Rnf216	A	G	5: 143,075,725		probably null	Het
Scn7a	G	T	2: 66,699,896	Q702K	probably benign	Het
Slc2a1	T	A	4: 119,132,143	N13K	probably damaging	Het
Tnr	A	G	1: 159,888,259	I864V	probably benign	Het
Tspyl3	A	T	2: 153,224,730	M196K	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Umod	T	C	7: 119,472,540	D326G	probably damaging	Het
Upf2	A	G	2: 5,976,079	D492G	unknown	Het
Vash1	A	G	12: 86,685,420	T126A	probably benign	Het
Vsig10l	T	A	7: 43,467,457	I574K	possibly damaging	Het

Other mutations in Erc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Erc2	APN	14	28040521	missense	probably damaging	0.98
IGL01862:Erc2	APN	14	28271569	splice site	probably benign
IGL01906:Erc2	APN	14	28141306	missense	probably damaging	0.99
IGL02177:Erc2	APN	14	27898623	missense	probably benign	0.00
IGL02481:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02483:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02623:Erc2	APN	14	27776980	missense	probably damaging	1.00
IGL03252:Erc2	APN	14	28475649	utr 3 prime	probably benign
IGL03378:Erc2	APN	14	28011723	missense	probably damaging	1.00
lobe	UTSW	14	28317251	missense	probably damaging	0.96
R0091:Erc2	UTSW	14	27776824	critical splice acceptor site	probably null
R0309:Erc2	UTSW	14	28141225	missense	probably damaging	0.98
R0357:Erc2	UTSW	14	27777022	missense	probably damaging	0.99
R0378:Erc2	UTSW	14	28011694	missense	probably damaging	1.00
R0550:Erc2	UTSW	14	28271651	missense	possibly damaging	0.74
R0815:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R0863:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R1121:Erc2	UTSW	14	28475655	utr 3 prime	probably benign
R1164:Erc2	UTSW	14	28302972	missense	probably damaging	0.99
R1498:Erc2	UTSW	14	28302898	missense	probably benign	0.27
R1500:Erc2	UTSW	14	28271660	missense	probably damaging	0.98
R1555:Erc2	UTSW	14	28011665	missense	probably damaging	0.99
R1894:Erc2	UTSW	14	28141228	missense	probably damaging	0.99
R1950:Erc2	UTSW	14	27912900	missense	probably damaging	0.99
R1991:Erc2	UTSW	14	28011636	missense	probably benign	0.34
R2698:Erc2	UTSW	14	28271705	missense	probably benign	0.06
R2847:Erc2	UTSW	14	28040488	missense	probably damaging	0.97
R3612:Erc2	UTSW	14	27777177	missense	possibly damaging	0.69
R3759:Erc2	UTSW	14	28025163	missense	possibly damaging	0.94
R3857:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3858:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3859:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R4556:Erc2	UTSW	14	28302904	missense	probably damaging	1.00
R4739:Erc2	UTSW	14	27776881	missense	probably damaging	1.00
R4898:Erc2	UTSW	14	27653328	missense	probably damaging	1.00
R5068:Erc2	UTSW	14	28302943	missense	possibly damaging	0.63
R5113:Erc2	UTSW	14	27652872	missense	probably benign	0.40
R5418:Erc2	UTSW	14	27966510	missense	probably benign	0.14
R5741:Erc2	UTSW	14	28302869	splice site	probably null
R5819:Erc2	UTSW	14	28141369	missense	probably damaging	0.97
R5930:Erc2	UTSW	14	27776858	missense	probably damaging	0.99
R6073:Erc2	UTSW	14	28011636	missense	probably benign	0.00
R6150:Erc2	UTSW	14	28141291	missense	probably damaging	0.97
R6182:Erc2	UTSW	14	28317253	missense	probably damaging	0.99
R6188:Erc2	UTSW	14	28317251	missense	probably damaging	0.96
R6267:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6296:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6730:Erc2	UTSW	14	27898567	missense	possibly damaging	0.95
R6969:Erc2	UTSW	14	27898596	missense	probably damaging	1.00
R7095:Erc2	UTSW	14	27898593	missense	probably damaging	0.99
R7221:Erc2	UTSW	14	27653158	missense	probably damaging	0.97
R7365:Erc2	UTSW	14	28040389	missense	probably damaging	1.00
R7454:Erc2	UTSW	14	28302991	missense	possibly damaging	0.92
R7763:Erc2	UTSW	14	27876204	critical splice donor site	probably null
R7784:Erc2	UTSW	14	27898594	missense	probably damaging	0.96
R7890:Erc2	UTSW	14	28040341	critical splice acceptor site	probably null
R7894:Erc2	UTSW	14	27777208	missense	probably damaging	1.00
R8031:Erc2	UTSW	14	28011692	missense	probably damaging	0.99
R8206:Erc2	UTSW	14	28303015	splice site	probably null
R8273:Erc2	UTSW	14	27777139	missense	probably benign	0.41
R8304:Erc2	UTSW	14	27653165	missense	probably damaging	0.99
R8387:Erc2	UTSW	14	27653296	missense	possibly damaging	0.92
R8751:Erc2	UTSW	14	28080188	missense	possibly damaging	0.78
R8851:Erc2	UTSW	14	28317259	missense	probably null	0.99
R9130:Erc2	UTSW	14	28029461	missense	probably benign	0.25
R9292:Erc2	UTSW	14	27776842	missense	probably damaging	1.00
R9441:Erc2	UTSW	14	28080157	missense	possibly damaging	0.58
R9452:Erc2	UTSW	14	28011733	missense	probably damaging	1.00
R9529:Erc2	UTSW	14	28475766	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CGAATCTTGGCTTTGGTTACATAG -3'
(R):5'- GACAGCCAAAGGTGATGCTG -3'

Sequencing Primer
(F):5'- CTTGGCTTTGGTTACATAGAAAATG -3'
(R):5'- CAGTTTCAAGAAGATGTCTGCAGTG -3'

Posted On

2015-01-11