Incidental Mutation 'R3015:Ints9'
ID 257656
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission 040536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3015 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 64950045-65039832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64950278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 3 (W3R)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022544] [ENSMUST00000043914] [ENSMUST00000067843] [ENSMUST00000175744] [ENSMUST00000175905] [ENSMUST00000176128] [ENSMUST00000176489] [ENSMUST00000176832]
AlphaFold Q8K114
Predicted Effect probably benign
Transcript: ENSMUST00000022544
SMART Domains Protein: ENSMUSP00000022544
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.3e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: W3R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: W3R

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067843
SMART Domains Protein: ENSMUSP00000066905
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.5e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175744
SMART Domains Protein: ENSMUSP00000135272
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175905
SMART Domains Protein: ENSMUSP00000135657
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.5e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176128
SMART Domains Protein: ENSMUSP00000135448
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 25 227 4.4e-66 PFAM
HOX 267 344 6.18e-9 SMART
low complexity region 373 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176489
SMART Domains Protein: ENSMUSP00000134824
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.1e-15 PFAM
HOX 267 355 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176657
Predicted Effect probably benign
Transcript: ENSMUST00000176832
SMART Domains Protein: ENSMUSP00000135211
Gene: ENSMUSG00000021972

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225790
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,875,462 F76Y probably damaging Het
Adamts9 T C 6: 92,872,932 H380R probably benign Het
Aff3 A T 1: 38,210,568 I486N probably benign Het
Cfap44 A C 16: 44,410,469 D271A probably benign Het
D430042O09Rik T A 7: 125,866,340 H1321Q probably damaging Het
Dbndd2 T A 2: 164,488,350 V34D probably damaging Het
Erc2 T A 14: 28,011,775 probably null Het
Fam159b T A 13: 104,858,391 I83F possibly damaging Het
Fcgbp T C 7: 28,075,413 probably benign Het
Frem3 T C 8: 80,690,773 S2036P probably damaging Het
Golph3l A G 3: 95,591,713 probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ifrd2 G A 9: 107,590,022 G60S probably null Het
Jmjd1c A G 10: 67,157,932 E64G probably damaging Het
Matn3 A C 12: 8,952,217 Q143P probably damaging Het
Myo18a A T 11: 77,859,020 probably benign Het
Nop9 T C 14: 55,751,174 S358P probably benign Het
Pard3b T C 1: 62,344,878 S801P probably damaging Het
Pax2 T C 19: 44,816,024 F268L probably damaging Het
Pik3r1 A G 13: 101,687,263 I538T probably damaging Het
Plekha8 T C 6: 54,622,122 S214P probably benign Het
Ppme1 T C 7: 100,331,877 H352R probably damaging Het
Ppp1r26 A C 2: 28,452,302 D648A probably damaging Het
Prom1 C A 5: 44,034,391 V337F probably damaging Het
Rapgef4 T C 2: 72,198,373 I378T probably damaging Het
Rnf115 T C 3: 96,754,359 S43P probably damaging Het
Rnf216 A G 5: 143,075,725 probably null Het
Scn7a G T 2: 66,699,896 Q702K probably benign Het
Slc2a1 T A 4: 119,132,143 N13K probably damaging Het
Tnr A G 1: 159,888,259 I864V probably benign Het
Tspyl3 A T 2: 153,224,730 M196K probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Umod T C 7: 119,472,540 D326G probably damaging Het
Upf2 A G 2: 5,976,079 D492G unknown Het
Vash1 A G 12: 86,685,420 T126A probably benign Het
Vsig10l T A 7: 43,467,457 I574K possibly damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
R8183:Ints9 UTSW 14 65036453 missense probably damaging 0.98
R8223:Ints9 UTSW 14 65020360 missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65007308 missense probably benign 0.00
R8314:Ints9 UTSW 14 65029030 missense probably damaging 1.00
R8341:Ints9 UTSW 14 65036414 missense probably benign 0.14
R8548:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9356:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9434:Ints9 UTSW 14 65008057 missense probably benign 0.00
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCATGGATGCTAGACCCAG -3'
(R):5'- TAAATCATGGTGGAGGCGAC -3'

Sequencing Primer
(F):5'- CCATGGATGCTAGACCCAGATGAG -3'
(R):5'- GGCGACAGACTCCAAAGATATATAGC -3'
Posted On 2015-01-11