Incidental Mutation 'R3017:Aplp1'
ID257667
Institutional Source Beutler Lab
Gene Symbol Aplp1
Ensembl Gene ENSMUSG00000006651
Gene Nameamyloid beta (A4) precursor-like protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3017 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30434982-30445535 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 30435971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828]
Predicted Effect probably null
Transcript: ENSMUST00000006828
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208792
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show a 10% decrease in body weight at 9 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T C 1: 58,235,204 V383A probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Gmnc G A 16: 26,960,415 H281Y probably benign Het
Gusb T C 5: 130,000,484 D152G probably damaging Het
Kcnk4 A T 19: 6,927,794 V163E probably damaging Het
Lcmt1 T G 7: 123,430,136 L327W probably damaging Het
Med18 G A 4: 132,459,817 R124C probably damaging Het
Odf1 A G 15: 38,226,431 T192A unknown Het
Pitpna C T 11: 75,592,190 R8W probably damaging Het
Pkn1 A G 8: 83,670,170 Y951H probably benign Het
Rad18 T C 6: 112,681,366 T193A possibly damaging Het
Ruvbl2 G T 7: 45,422,164 L432I probably damaging Het
Slco1a4 T C 6: 141,812,670 probably null Het
Tlr11 T A 14: 50,362,721 C721* probably null Het
Tubgcp6 A T 15: 89,103,082 C1229* probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Other mutations in Aplp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Aplp1 APN 7 30444418 missense probably damaging 0.97
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0034:Aplp1 UTSW 7 30444442 missense probably damaging 1.00
R1480:Aplp1 UTSW 7 30436023 missense probably benign 0.01
R1538:Aplp1 UTSW 7 30436027 missense probably benign
R2177:Aplp1 UTSW 7 30442521 nonsense probably null
R5143:Aplp1 UTSW 7 30441123 missense probably damaging 1.00
R5465:Aplp1 UTSW 7 30436852 missense probably benign
R5482:Aplp1 UTSW 7 30440175 missense probably damaging 1.00
R5530:Aplp1 UTSW 7 30436829 missense possibly damaging 0.70
R6112:Aplp1 UTSW 7 30435477 missense probably damaging 1.00
R6721:Aplp1 UTSW 7 30440295 missense probably null 1.00
R6931:Aplp1 UTSW 7 30443200 missense probably damaging 1.00
R7314:Aplp1 UTSW 7 30435989 missense probably damaging 0.98
R7707:Aplp1 UTSW 7 30443098 missense probably damaging 1.00
R7980:Aplp1 UTSW 7 30435567 missense probably benign 0.44
R8005:Aplp1 UTSW 7 30436045 critical splice acceptor site probably null
R8126:Aplp1 UTSW 7 30441739 missense probably damaging 1.00
Z1177:Aplp1 UTSW 7 30438189 missense probably benign 0.44
Z1177:Aplp1 UTSW 7 30438279 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGGATATCTGACGAGTGG -3'
(R):5'- GGTCATCAAATCCCTCTGAACC -3'

Sequencing Primer
(F):5'- TCGGGGCGGATGCATTC -3'
(R):5'- TCTGAACCCTAAACCACGAAGGG -3'
Posted On2015-01-11