Incidental Mutation 'R3018:Rad51ap1'
ID257688
Institutional Source Beutler Lab
Gene Symbol Rad51ap1
Ensembl Gene ENSMUSG00000030346
Gene NameRAD51 associated protein 1
SynonymsRAB22, 2510006L10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3018 (G1)
Quality Score101
Status Not validated
Chromosome6
Chromosomal Location126923050-126939587 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 126939522 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032497] [ENSMUST00000112220] [ENSMUST00000112221] [ENSMUST00000144954] [ENSMUST00000201617] [ENSMUST00000202897]
Predicted Effect probably benign
Transcript: ENSMUST00000032497
SMART Domains Protein: ENSMUSP00000032497
Gene: ENSMUSG00000030347

DomainStartEndE-ValueType
Pfam:DUF2362 41 546 4.4e-218 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112220
SMART Domains Protein: ENSMUSP00000107839
Gene: ENSMUSG00000030346

DomainStartEndE-ValueType
low complexity region 179 204 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112221
SMART Domains Protein: ENSMUSP00000107841
Gene: ENSMUSG00000030346

DomainStartEndE-ValueType
low complexity region 180 205 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
Pfam:RAD51_interact 293 331 1.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141212
Predicted Effect probably null
Transcript: ENSMUST00000144954
SMART Domains Protein: ENSMUSP00000122978
Gene: ENSMUSG00000030346

DomainStartEndE-ValueType
low complexity region 121 146 N/A INTRINSIC
low complexity region 153 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201603
Predicted Effect probably benign
Transcript: ENSMUST00000201617
SMART Domains Protein: ENSMUSP00000144570
Gene: ENSMUSG00000030347

DomainStartEndE-ValueType
Pfam:DUF2362 41 83 2.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202835
Predicted Effect probably benign
Transcript: ENSMUST00000202897
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T C 1: 127,749,116 V126A probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Dnm3 T A 1: 162,321,759 K206* probably null Het
Grxcr1 C T 5: 68,110,517 S203F probably damaging Het
Matn3 A T 12: 8,963,578 D420V probably benign Het
Mlf2 G T 6: 124,932,504 M48I probably benign Het
Moxd2 T A 6: 40,878,886 T590S probably benign Het
Myh2 A G 11: 67,179,584 D451G possibly damaging Het
Neurod4 T C 10: 130,270,955 E150G probably damaging Het
Nynrin A T 14: 55,863,410 E219V probably benign Het
Rpl38 T A 11: 114,668,935 F11L possibly damaging Het
Serinc5 T C 13: 92,688,681 M206T probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tnk1 C T 11: 69,854,911 probably benign Het
Trim41 G T 11: 48,807,694 R482S probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp292 G A 4: 34,808,814 T1410I probably damaging Het
Other mutations in Rad51ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Rad51ap1 APN 6 126928160 missense probably damaging 1.00
IGL02371:Rad51ap1 APN 6 126927564 missense probably benign 0.14
IGL02398:Rad51ap1 APN 6 126928151 missense probably damaging 1.00
R0265:Rad51ap1 UTSW 6 126924197 makesense probably null
R0359:Rad51ap1 UTSW 6 126934741 missense probably damaging 1.00
R0488:Rad51ap1 UTSW 6 126934760 missense possibly damaging 0.94
R1527:Rad51ap1 UTSW 6 126928167 splice site probably null
R4464:Rad51ap1 UTSW 6 126934768 missense possibly damaging 0.94
R4691:Rad51ap1 UTSW 6 126927553 missense probably benign
R5314:Rad51ap1 UTSW 6 126928158 missense probably damaging 1.00
R5469:Rad51ap1 UTSW 6 126928227 missense probably damaging 0.96
R7177:Rad51ap1 UTSW 6 126925020 missense probably benign 0.08
R8026:Rad51ap1 UTSW 6 126934712 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCAAATGCTAGCCTACCAGGTC -3'
(R):5'- TCTGAGCAGACAGGATCCAG -3'

Sequencing Primer
(F):5'- AGCCTACCAGGTCCCTCTG -3'
(R):5'- CAGGATCCAGGATGGCGTG -3'
Posted On2015-01-11