Incidental Mutation 'R3018:Matn3'
ID257694
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3018 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8963578 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 420 (D420V)
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably benign
Transcript: ENSMUST00000020899
AA Change: D420V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583
AA Change: D420V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T C 1: 127,749,116 V126A probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Dnm3 T A 1: 162,321,759 K206* probably null Het
Grxcr1 C T 5: 68,110,517 S203F probably damaging Het
Mlf2 G T 6: 124,932,504 M48I probably benign Het
Moxd2 T A 6: 40,878,886 T590S probably benign Het
Myh2 A G 11: 67,179,584 D451G possibly damaging Het
Neurod4 T C 10: 130,270,955 E150G probably damaging Het
Nynrin A T 14: 55,863,410 E219V probably benign Het
Rad51ap1 T C 6: 126,939,522 probably null Het
Rpl38 T A 11: 114,668,935 F11L possibly damaging Het
Serinc5 T C 13: 92,688,681 M206T probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Tnk1 C T 11: 69,854,911 probably benign Het
Trim41 G T 11: 48,807,694 R482S probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Zfp292 G A 4: 34,808,814 T1410I probably damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0585:Matn3 UTSW 12 8961103 splice site probably benign
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3015:Matn3 UTSW 12 8952217 missense probably damaging 0.97
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5308:Matn3 UTSW 12 8952308 frame shift probably null
R5616:Matn3 UTSW 12 8948195 missense probably benign
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R5849:Matn3 UTSW 12 8958829 missense probably benign 0.10
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
RF001:Matn3 UTSW 12 8958797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGACATTTGTGTATAGTGGCC -3'
(R):5'- TAACTGCTGCCACAGAGCTG -3'

Sequencing Primer
(F):5'- AGTGGCCTACTTAACTAATGGG -3'
(R):5'- AGGAGCTTCCTCCTACAT -3'
Posted On2015-01-11