Incidental Mutation 'R3019:Vmn1r64'
ID257710
Institutional Source Beutler Lab
Gene Symbol Vmn1r64
Ensembl Gene ENSMUSG00000058399
Gene Namevomeronasal 1 receptor 64
SynonymsV1rd11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3019 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5883580-5884590 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5884227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 106 (S106P)
Ref Sequence ENSEMBL: ENSMUSP00000077568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078475]
Predicted Effect probably damaging
Transcript: ENSMUST00000078475
AA Change: S106P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077568
Gene: ENSMUSG00000058399
AA Change: S106P

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 3.3e-13 PFAM
Pfam:V1R 41 296 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atr C A 9: 95,905,818 A1488E possibly damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Birc3 C T 9: 7,857,389 probably null Het
Cntnap5a T C 1: 116,101,569 L251P probably benign Het
Fryl G T 5: 73,082,850 H1406N probably benign Het
Heatr6 T A 11: 83,778,832 probably null Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lamb3 T C 1: 193,331,409 probably null Het
Lhx5 G T 5: 120,440,005 A297S probably benign Het
Med18 G A 4: 132,459,817 R124C probably damaging Het
Synpo2 A G 3: 123,113,579 V696A probably damaging Het
Tgfbr3 C A 5: 107,137,546 R563L possibly damaging Het
Tm6sf1 A G 7: 81,876,065 T207A probably benign Het
Vmn1r56 C A 7: 5,196,062 M185I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Other mutations in Vmn1r64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Vmn1r64 APN 7 5883828 missense probably damaging 0.98
IGL01070:Vmn1r64 APN 7 5883942 missense probably benign 0.04
IGL01817:Vmn1r64 APN 7 5884223 missense probably damaging 1.00
IGL02026:Vmn1r64 APN 7 5883650 missense possibly damaging 0.84
IGL02657:Vmn1r64 APN 7 5883728 missense probably benign 0.33
IGL03352:Vmn1r64 APN 7 5884071 missense probably benign 0.12
R0200:Vmn1r64 UTSW 7 5883818 missense probably benign 0.38
R0540:Vmn1r64 UTSW 7 5884097 missense probably damaging 1.00
R0655:Vmn1r64 UTSW 7 5884208 missense probably benign 0.25
R1212:Vmn1r64 UTSW 7 5884211 missense probably damaging 1.00
R1579:Vmn1r64 UTSW 7 5883804 missense probably damaging 1.00
R2034:Vmn1r64 UTSW 7 5883989 missense probably benign 0.09
R2221:Vmn1r64 UTSW 7 5884449 missense probably benign 0.00
R2240:Vmn1r64 UTSW 7 5884370 nonsense probably null
R2305:Vmn1r64 UTSW 7 5884536 missense probably benign 0.04
R4256:Vmn1r64 UTSW 7 5883896 missense probably benign 0.05
R4666:Vmn1r64 UTSW 7 5884358 missense probably damaging 0.99
R4996:Vmn1r64 UTSW 7 5884053 missense probably benign 0.03
R5682:Vmn1r64 UTSW 7 5883623 missense possibly damaging 0.79
R5730:Vmn1r64 UTSW 7 5884523 missense probably benign 0.01
R7397:Vmn1r64 UTSW 7 5884014 missense possibly damaging 0.87
X0063:Vmn1r64 UTSW 7 5884350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGACCACTGACATACATTG -3'
(R):5'- GGACTGTGGGCAACATCTTTC -3'

Sequencing Primer
(F):5'- CCACTGACATACATTGGCATGTAAG -3'
(R):5'- TTGACTGACTCCCGACTGAG -3'
Posted On2015-01-11