Mutagenetix > Incidental Mutations

Incidental Mutation 'R0326:Lama5'

25773

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

038536-MU

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0326 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 180182426 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 2602 (V2602D)

Ref Sequence

ENSEMBL: ENSMUSP00000015791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791]

PDB Structure

LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015791
AA Change: V2602D

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: V2602D

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130796

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185089

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.8%
20x: 91.8%

Validation Efficiency

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	C	T	1: 130,742,898	P286S	possibly damaging	Het
Aagab	T	A	9: 63,619,162	S156T	probably damaging	Het
Abca14	T	G	7: 120,224,419	Y390D	probably damaging	Het
Abcc2	T	A	19: 43,825,947	I1122N	possibly damaging	Het
Adamts16	T	C	13: 70,779,611	E503G	possibly damaging	Het
Adamts9	A	T	6: 92,858,057	C697*	probably null	Het
Adgrv1	T	C	13: 81,474,993	D3837G	possibly damaging	Het
Aire	T	A	10: 78,042,599	R128S	probably damaging	Het
Alkbh2	A	C	5: 114,123,950	*240E	probably null	Het
Als2	T	C	1: 59,180,583	Y1191C	probably damaging	Het
Anapc5	A	T	5: 122,814,604	V186E	probably benign	Het
Apob	C	T	12: 7,990,307	A548V	probably damaging	Het
B3galt4	A	T	17: 33,950,748	V172E	probably damaging	Het
Bbs7	A	C	3: 36,592,376	C432G	possibly damaging	Het
Cacna2d3	T	A	14: 29,045,644	E758V	probably damaging	Het
Cactin	T	G	10: 81,322,662	L154R	probably benign	Het
Ccdc129	A	T	6: 55,898,243	M393L	possibly damaging	Het
Ccdc88a	A	C	11: 29,461,021	R502S	probably benign	Het
Ccnf	A	T	17: 24,231,810	I398N	possibly damaging	Het
Chd1	A	T	17: 15,768,566	D1527V	probably damaging	Het
Chd1	A	T	17: 15,768,568	M1528L	probably benign	Het
Chrac1	G	A	15: 73,092,826		probably null	Het
Cln3	T	G	7: 126,583,045	M1L	probably damaging	Het
Cnot6	T	C	11: 49,677,436	Y442C	probably damaging	Het
Col19a1	A	T	1: 24,285,051		probably null	Het
Col1a2	T	C	6: 4,537,838	F1116L	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cops4	T	G	5: 100,528,542	V53G	probably damaging	Het
Crnkl1	A	G	2: 145,919,955	S561P	probably benign	Het
Ctnnb1	C	A	9: 120,951,712	Q99K	probably benign	Het
Cxcr5	T	C	9: 44,513,281	S360G	probably benign	Het
Dab2	G	A	15: 6,418,316	V60M	probably damaging	Het
Ddx3y	A	T	Y: 1,263,321	Y648*	probably null	Het
Dennd2a	T	A	6: 39,497,110	D430V	probably damaging	Het
Dsp	G	T	13: 38,192,870	E1544*	probably null	Het
Efcab7	A	T	4: 99,831,394	M38L	possibly damaging	Het
Fto	A	G	8: 91,409,527	N141S	probably damaging	Het
Gabrp	A	G	11: 33,554,362	F318L	probably damaging	Het
Gm4737	T	A	16: 46,153,883	D377V	probably benign	Het
Gmeb1	A	C	4: 132,242,352	C103W	probably damaging	Het
Heatr9	T	C	11: 83,514,539	D365G	probably damaging	Het
Hif3a	G	A	7: 17,044,400	R436W	probably benign	Het
Hint2	A	G	4: 43,654,378	V145A	probably damaging	Het
Hmcn2	T	A	2: 31,423,225	L3482*	probably null	Het
Hsd3b1	A	T	3: 98,853,274	Y134N	probably damaging	Het
Impg2	T	A	16: 56,260,485	V775E	probably damaging	Het
Ipo5	A	G	14: 120,922,223	I154M	probably benign	Het
Itgad	T	A	7: 128,198,378	F893Y	probably benign	Het
Kdm4a	T	C	4: 118,161,706	R438G	probably benign	Het
Klk11	T	A	7: 43,776,519	M1K	probably null	Het
Lrch3	T	C	16: 32,979,500	S35P	probably damaging	Het
Mfn2	A	G	4: 147,883,288	L441P	probably damaging	Het
Mgat4c	A	T	10: 102,388,704	I260F	probably damaging	Het
Mon1b	T	A	8: 113,637,743	S51T	probably benign	Het
Myh11	T	C	16: 14,218,880	D993G	probably benign	Het
Myo1a	A	G	10: 127,716,297	N762D	probably benign	Het
Nacc2	A	T	2: 26,060,333	Y464N	probably damaging	Het
Nckap1	A	G	2: 80,553,370	I150T	probably benign	Het
Ndufv2	G	T	17: 66,080,821	P119T	probably damaging	Het
Noc4l	G	A	5: 110,652,375	R95*	probably null	Het
Ntng1	A	T	3: 110,135,503	Y2*	probably null	Het
Olfr1333	A	T	4: 118,829,825	V205D	possibly damaging	Het
Olfr1423	C	T	19: 12,036,161	V194I	probably benign	Het
Olfr1505	C	T	19: 13,919,509	T163I	probably benign	Het
Olfr804	A	G	10: 129,705,769	E297G	possibly damaging	Het
Oog4	T	C	4: 143,439,203	N53D	probably benign	Het
Phkg2	T	G	7: 127,573,903	L11R	probably damaging	Het
Pogz	A	G	3: 94,870,113	D368G	probably damaging	Het
Prex2	T	A	1: 11,285,065	L1530Q	probably damaging	Het
Prmt1	C	T	7: 44,979,454	E144K	probably damaging	Het
Prss8	T	A	7: 127,927,176	I121F	probably benign	Het
Psmd13	T	C	7: 140,897,711	L314P	probably damaging	Het
Ptch2	G	A	4: 117,108,884	G467D	probably damaging	Het
Rbm20	C	A	19: 53,864,165	P1192Q	probably damaging	Het
Rpl19	T	A	11: 98,028,374	D45E	probably benign	Het
Rsph10b	C	T	5: 143,967,128	A219V	probably damaging	Het
Rtraf	C	T	14: 19,814,532		probably null	Het
Scaf1	T	A	7: 45,008,751	T235S	probably damaging	Het
Shank1	T	A	7: 44,319,170	C296S	unknown	Het
Slc39a7	A	T	17: 34,028,950	V426D	probably damaging	Het
Slc41a2	A	T	10: 83,283,746	V384D	probably damaging	Het
Slco1c1	T	C	6: 141,559,773	L475P	probably benign	Het
Slco6d1	A	C	1: 98,490,634	K515T	probably benign	Het
Sos2	T	C	12: 69,635,685	E253G	probably damaging	Het
Sp6	G	T	11: 97,021,535	D25Y	possibly damaging	Het
Syt11	A	C	3: 88,762,548	D12E	possibly damaging	Het
Taf2	A	G	15: 55,047,460	L606P	probably damaging	Het
Tbc1d5	A	G	17: 50,966,736	Y116H	probably damaging	Het
Tnfrsf8	A	G	4: 145,288,459	I243T	possibly damaging	Het
Tnxb	A	G	17: 34,698,179	S2183G	probably benign	Het
Trim66	T	C	7: 109,460,172	Y853C	probably benign	Het
Ttn	T	A	2: 76,737,495	T27685S	probably damaging	Het
Ttn	T	C	2: 76,743,122	E25809G	probably damaging	Het
Uvssa	G	A	5: 33,408,847	G445S	probably benign	Het
Zfp326	T	C	5: 105,910,275	S427P	probably damaging	Het
Zfp592	A	G	7: 81,024,889	T534A	possibly damaging	Het
Zfp672	A	G	11: 58,316,347	S383P	possibly damaging	Het
Zfp799	A	G	17: 32,820,726	S188P	possibly damaging	Het
Zyg11b	A	C	4: 108,272,253	V54G	possibly damaging	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0003:Lama5	UTSW	2	180178079	splice site	probably null
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0148:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1078:Lama5	UTSW	2	180179764	unclassified	probably benign
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5319:Lama5	UTSW	2	180181118	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6406:Lama5	UTSW	2	180197464	nonsense	probably null
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7699:Lama5	UTSW	2	180180861	missense	probably damaging	1.00
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R8153:Lama5	UTSW	2	180187931	missense	probably benign	0.37
R8317:Lama5	UTSW	2	180206991	missense	probably damaging	1.00
R8351:Lama5	UTSW	2	180195608	missense	probably damaging	1.00
R8370:Lama5	UTSW	2	180201487	missense	possibly damaging	0.80
R8398:Lama5	UTSW	2	180197034	critical splice donor site	probably null
R8401:Lama5	UTSW	2	180198787	missense	probably damaging	1.00
R8404:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8502:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTAACTACCCCAGTGCCAAGTG -3'
(R):5'- ACTAAATGTGCCTGCCCTATGTGTC -3'

Sequencing Primer
(F):5'- AGTGCCAAGTGCCTACAG -3'
(R):5'- GATCTACTGGCGCgggg -3'

Posted On

2013-04-16