Mutagenetix > Incidental Mutation

Incidental Mutation 'R3021:Inpp4b'

257745

Institutional Source

Beutler Lab

Gene Symbol

Inpp4b

Ensembl Gene

ENSMUSG00000037940

Gene Name

inositol polyphosphate-4-phosphatase, type II

Synonyms

E130107I17Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R3021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82069185-82854543 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82629467 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 267 (E267D)

Ref Sequence

ENSEMBL: ENSMUSP00000148972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]

AlphaFold

Q6P1Y8

Predicted Effect

probably benign
Transcript: ENSMUST00000042529
AA Change: E250D

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: E250D

Domain	Start	End	E-Value	Type
C2	40	147	1.72e0	SMART
low complexity region	302	319	N/A	INTRINSIC
low complexity region	425	434	N/A	INTRINSIC
transmembrane domain	898	920	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109851
AA Change: E135D

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: E135D

Domain	Start	End	E-Value	Type
low complexity region	22	35	N/A	INTRINSIC
low complexity region	187	204	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
transmembrane domain	783	805	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109852
AA Change: E267D

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: E267D

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC
transmembrane domain	915	937	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164264
AA Change: E176D

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165821

Predicted Effect

probably benign
Transcript: ENSMUST00000169116
AA Change: E267D

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940
AA Change: E267D

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169387

Predicted Effect

probably benign
Transcript: ENSMUST00000170160
AA Change: E82D

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940
AA Change: E82D

Domain	Start	End	E-Value	Type
low complexity region	134	151	N/A	INTRINSIC
low complexity region	257	266	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172031
AA Change: E267D

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: E267D

Domain	Start	End	E-Value	Type
C2	40	164	5.29e0	SMART
low complexity region	319	336	N/A	INTRINSIC
low complexity region	442	451	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213285
AA Change: E267D

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215332
AA Change: E267D

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000217122
AA Change: E267D

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216387

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1c1	T	C	15: 38,689,460 (GRCm39)	V307A	possibly damaging	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Ccdc85a	T	C	11: 28,526,894 (GRCm39)	E210G	possibly damaging	Het
Dennd1c	C	T	17: 57,381,180 (GRCm39)		probably null	Het
Eng	T	C	2: 32,568,580 (GRCm39)	V474A	probably damaging	Het
Fam114a2	T	C	11: 57,390,625 (GRCm39)	D303G	probably benign	Het
Fat1	T	A	8: 45,497,048 (GRCm39)	C4178S	probably damaging	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Itch	A	G	2: 155,051,046 (GRCm39)	K578E	possibly damaging	Het
Mttp	T	C	3: 137,817,464 (GRCm39)	M444V	probably benign	Het
Or2a56	T	C	6: 42,933,118 (GRCm39)	S229P	possibly damaging	Het
Pgm3	A	T	9: 86,449,588 (GRCm39)	V144E	possibly damaging	Het
Ppp3cb	A	T	14: 20,573,921 (GRCm39)	Y271*	probably null	Het
Pramel31	T	A	4: 144,088,369 (GRCm39)	M55K	probably damaging	Het
Ptk2b	A	T	14: 66,415,632 (GRCm39)		probably null	Het
Rdh1	G	A	10: 127,596,077 (GRCm39)	V91M	possibly damaging	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Smad2	T	G	18: 76,395,703 (GRCm39)	S47R	probably damaging	Het
Smchd1	G	T	17: 71,694,093 (GRCm39)	S1217R	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,509,906 (GRCm39)		probably null	Het

Other mutations in Inpp4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Inpp4b	APN	8	82,583,379 (GRCm39)	missense	probably damaging	1.00
IGL01481:Inpp4b	APN	8	82,724,009 (GRCm39)	missense	probably damaging	1.00
IGL01509:Inpp4b	APN	8	82,617,332 (GRCm39)	splice site	probably benign
IGL01515:Inpp4b	APN	8	82,679,340 (GRCm39)	missense	possibly damaging	0.68
IGL01607:Inpp4b	APN	8	82,737,292 (GRCm39)	missense	probably benign	0.03
IGL01643:Inpp4b	APN	8	82,798,400 (GRCm39)	missense	probably damaging	0.97
IGL01736:Inpp4b	APN	8	82,723,968 (GRCm39)	missense	probably benign	0.00
IGL02154:Inpp4b	APN	8	82,696,130 (GRCm39)	splice site	probably benign
IGL02327:Inpp4b	APN	8	82,768,591 (GRCm39)	missense	probably benign	0.01
IGL02413:Inpp4b	APN	8	82,759,800 (GRCm39)	missense	probably benign
IGL02652:Inpp4b	APN	8	82,497,429 (GRCm39)	splice site	probably benign
IGL02678:Inpp4b	APN	8	82,583,373 (GRCm39)	missense	probably damaging	1.00
IGL03146:Inpp4b	APN	8	82,470,410 (GRCm39)	missense	possibly damaging	0.61
LCD18:Inpp4b	UTSW	8	82,419,639 (GRCm39)	intron	probably benign
PIT4280001:Inpp4b	UTSW	8	82,761,046 (GRCm39)	missense	probably benign	0.00
PIT4480001:Inpp4b	UTSW	8	82,772,896 (GRCm39)	missense	probably damaging	1.00
PIT4504001:Inpp4b	UTSW	8	82,768,564 (GRCm39)	missense	probably damaging	1.00
R0083:Inpp4b	UTSW	8	82,468,091 (GRCm39)	missense	possibly damaging	0.77
R0212:Inpp4b	UTSW	8	82,497,546 (GRCm39)	missense	probably benign	0.00
R0285:Inpp4b	UTSW	8	82,761,145 (GRCm39)	splice site	probably benign
R0363:Inpp4b	UTSW	8	82,610,886 (GRCm39)	splice site	probably benign
R0364:Inpp4b	UTSW	8	82,723,943 (GRCm39)	missense	probably benign	0.09
R0471:Inpp4b	UTSW	8	82,768,528 (GRCm39)	missense	possibly damaging	0.94
R0550:Inpp4b	UTSW	8	82,723,966 (GRCm39)	missense	probably benign	0.00
R0562:Inpp4b	UTSW	8	82,494,780 (GRCm39)	missense	possibly damaging	0.88
R0661:Inpp4b	UTSW	8	82,468,091 (GRCm39)	missense	possibly damaging	0.77
R0693:Inpp4b	UTSW	8	82,723,943 (GRCm39)	missense	probably benign	0.09
R1081:Inpp4b	UTSW	8	82,795,653 (GRCm39)	missense	probably damaging	0.97
R1251:Inpp4b	UTSW	8	82,617,382 (GRCm39)	missense	probably benign	0.01
R1374:Inpp4b	UTSW	8	82,470,445 (GRCm39)	critical splice donor site	probably null
R1445:Inpp4b	UTSW	8	82,679,463 (GRCm39)	splice site	probably null
R1465:Inpp4b	UTSW	8	82,494,786 (GRCm39)	missense	probably damaging	1.00
R1465:Inpp4b	UTSW	8	82,494,786 (GRCm39)	missense	probably damaging	1.00
R1647:Inpp4b	UTSW	8	82,583,403 (GRCm39)	splice site	probably benign
R1754:Inpp4b	UTSW	8	82,497,440 (GRCm39)	missense	probably damaging	1.00
R1759:Inpp4b	UTSW	8	82,494,732 (GRCm39)	missense	probably benign	0.06
R2085:Inpp4b	UTSW	8	82,678,903 (GRCm39)	missense	probably damaging	1.00
R2156:Inpp4b	UTSW	8	82,775,118 (GRCm39)	missense	probably damaging	1.00
R2160:Inpp4b	UTSW	8	82,848,004 (GRCm39)	nonsense	probably null
R2175:Inpp4b	UTSW	8	82,583,328 (GRCm39)	missense	probably damaging	1.00
R2191:Inpp4b	UTSW	8	82,723,931 (GRCm39)	missense	probably damaging	1.00
R2401:Inpp4b	UTSW	8	82,723,968 (GRCm39)	missense	probably benign	0.00
R2475:Inpp4b	UTSW	8	82,768,607 (GRCm39)	missense	probably benign	0.09
R2512:Inpp4b	UTSW	8	82,737,179 (GRCm39)	missense	probably damaging	1.00
R2919:Inpp4b	UTSW	8	82,711,958 (GRCm39)	missense	possibly damaging	0.93
R3423:Inpp4b	UTSW	8	82,678,890 (GRCm39)	missense	possibly damaging	0.63
R3777:Inpp4b	UTSW	8	82,768,621 (GRCm39)	missense	possibly damaging	0.89
R3778:Inpp4b	UTSW	8	82,768,621 (GRCm39)	missense	possibly damaging	0.89
R3794:Inpp4b	UTSW	8	82,759,845 (GRCm39)	missense	probably damaging	1.00
R3795:Inpp4b	UTSW	8	82,759,845 (GRCm39)	missense	probably damaging	1.00
R4590:Inpp4b	UTSW	8	82,468,040 (GRCm39)	start codon destroyed	probably null	1.00
R4602:Inpp4b	UTSW	8	82,696,164 (GRCm39)	missense	probably damaging	0.99
R4691:Inpp4b	UTSW	8	82,849,282 (GRCm39)	missense	probably damaging	1.00
R4924:Inpp4b	UTSW	8	82,849,253 (GRCm39)	missense	probably damaging	1.00
R4992:Inpp4b	UTSW	8	82,759,837 (GRCm39)	missense	probably damaging	1.00
R5219:Inpp4b	UTSW	8	82,610,785 (GRCm39)	missense	probably benign	0.01
R5228:Inpp4b	UTSW	8	82,494,744 (GRCm39)	missense	probably damaging	0.99
R5557:Inpp4b	UTSW	8	82,678,888 (GRCm39)	missense	probably damaging	0.99
R5627:Inpp4b	UTSW	8	82,470,445 (GRCm39)	critical splice donor site	probably benign
R5691:Inpp4b	UTSW	8	82,617,323 (GRCm39)	intron	probably benign
R6186:Inpp4b	UTSW	8	82,772,863 (GRCm39)	missense	probably damaging	0.99
R6213:Inpp4b	UTSW	8	82,724,019 (GRCm39)	missense	probably damaging	1.00
R6232:Inpp4b	UTSW	8	82,678,813 (GRCm39)	missense	probably damaging	1.00
R6283:Inpp4b	UTSW	8	82,497,462 (GRCm39)	missense	probably damaging	1.00
R6302:Inpp4b	UTSW	8	82,494,806 (GRCm39)	missense	probably benign	0.00
R6309:Inpp4b	UTSW	8	82,768,546 (GRCm39)	missense	probably damaging	1.00
R6360:Inpp4b	UTSW	8	82,629,481 (GRCm39)	missense	probably benign	0.20
R6477:Inpp4b	UTSW	8	82,571,343 (GRCm39)	splice site	probably null
R6773:Inpp4b	UTSW	8	82,583,249 (GRCm39)	intron	probably benign
R6968:Inpp4b	UTSW	8	82,571,086 (GRCm39)	missense	probably benign	0.18
R7147:Inpp4b	UTSW	8	82,629,400 (GRCm39)	missense	probably damaging	1.00
R7318:Inpp4b	UTSW	8	82,798,374 (GRCm39)	missense	probably damaging	1.00
R7409:Inpp4b	UTSW	8	82,679,314 (GRCm39)	splice site	probably null
R7455:Inpp4b	UTSW	8	82,798,332 (GRCm39)	missense	probably damaging	0.99
R7632:Inpp4b	UTSW	8	82,772,968 (GRCm39)	missense	probably damaging	1.00
R7844:Inpp4b	UTSW	8	82,467,949 (GRCm39)	start gained	probably benign
R7958:Inpp4b	UTSW	8	82,696,218 (GRCm39)	missense	probably damaging	1.00
R8440:Inpp4b	UTSW	8	82,768,524 (GRCm39)	missense	probably damaging	1.00
R9160:Inpp4b	UTSW	8	82,610,782 (GRCm39)	missense	possibly damaging	0.55
R9303:Inpp4b	UTSW	8	82,759,758 (GRCm39)	missense	probably damaging	1.00
R9390:Inpp4b	UTSW	8	82,497,522 (GRCm39)	missense	probably damaging	1.00
R9583:Inpp4b	UTSW	8	82,497,555 (GRCm39)	critical splice donor site	probably null
R9705:Inpp4b	UTSW	8	82,772,890 (GRCm39)	missense	probably benign	0.14
R9778:Inpp4b	UTSW	8	82,775,160 (GRCm39)	missense	probably benign
RF003:Inpp4b	UTSW	8	82,696,150 (GRCm39)	nonsense	probably null
Z1088:Inpp4b	UTSW	8	82,795,560 (GRCm39)	critical splice acceptor site	probably null
Z1176:Inpp4b	UTSW	8	82,795,630 (GRCm39)	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- TGGGTTTCAGACACTAACACC -3'
(R):5'- AGGCCCCAGGAAAGTAGATC -3'

Sequencing Primer
(F):5'- TGGTAAACAAAACATTTCTCTGATTG -3'
(R):5'- GGCCCCAGGAAAGTAGATCATTAAC -3'

Posted On

2015-01-11