Incidental Mutation 'R3021:Rdh1'
ID 257747
Institutional Source Beutler Lab
Gene Symbol Rdh1
Ensembl Gene ENSMUSG00000089789
Gene Name retinol dehydrogenase 1 (all trans)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R3021 (G1)
Quality Score 109
Status Not validated
Chromosome 10
Chromosomal Location 127759721-127768297 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 127760208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 91 (V91M)
Ref Sequence ENSEMBL: ENSMUSP00000116574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073639] [ENSMUST00000128247]
AlphaFold Q8CGV4
Predicted Effect possibly damaging
Transcript: ENSMUST00000073639
AA Change: V91M

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073322
Gene: ENSMUSG00000089789
AA Change: V91M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 222 5.7e-43 PFAM
Pfam:DUF1776 43 303 3.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128247
AA Change: V91M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009
AA Change: V91M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, adipose tissue, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1c1 T C 15: 38,689,216 V307A possibly damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccdc85a T C 11: 28,576,894 E210G possibly damaging Het
Dennd1c C T 17: 57,074,180 probably null Het
Eng T C 2: 32,678,568 V474A probably damaging Het
Fam114a2 T C 11: 57,499,799 D303G probably benign Het
Fat1 T A 8: 45,044,011 C4178S probably damaging Het
Gm13119 T A 4: 144,361,799 M55K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Inpp4b A T 8: 81,902,838 E267D possibly damaging Het
Itch A G 2: 155,209,126 K578E possibly damaging Het
Mttp T C 3: 138,111,703 M444V probably benign Het
Olfr444 T C 6: 42,956,184 S229P possibly damaging Het
Pgm3 A T 9: 86,567,535 V144E possibly damaging Het
Ppp3cb A T 14: 20,523,853 Y271* probably null Het
Ptk2b A T 14: 66,178,183 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smad2 T G 18: 76,262,632 S47R probably damaging Het
Smchd1 G T 17: 71,387,098 S1217R possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Other mutations in Rdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Rdh1 APN 10 127765419 missense probably benign 0.06
R0077:Rdh1 UTSW 10 127760037 missense probably damaging 1.00
R0481:Rdh1 UTSW 10 127763124 missense probably damaging 1.00
R0511:Rdh1 UTSW 10 127764783 missense probably benign
R0558:Rdh1 UTSW 10 127759941 missense possibly damaging 0.88
R1569:Rdh1 UTSW 10 127763072 missense probably benign
R1993:Rdh1 UTSW 10 127765345 missense probably benign
R2164:Rdh1 UTSW 10 127760172 missense possibly damaging 0.89
R5268:Rdh1 UTSW 10 127759963 missense possibly damaging 0.67
R6126:Rdh1 UTSW 10 127763214 missense probably damaging 1.00
R6216:Rdh1 UTSW 10 127764753 missense probably benign 0.00
R7017:Rdh1 UTSW 10 127763037 missense probably benign 0.02
R7332:Rdh1 UTSW 10 127759885 start gained probably benign
R7397:Rdh1 UTSW 10 127760178 missense probably benign 0.24
R7721:Rdh1 UTSW 10 127760252 critical splice donor site probably null
R7724:Rdh1 UTSW 10 127764707 missense possibly damaging 0.46
R7873:Rdh1 UTSW 10 127760023 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTTCTTTAGGGAGAGGCAG -3'
(R):5'- AGTACTCAGGTGATGTACTGGG -3'

Sequencing Primer
(F):5'- ACAAGTATGTCTTCATCACGGGC -3'
(R):5'- TACTGGGTTACTTCAGGGCCC -3'
Posted On 2015-01-11