Incidental Mutation 'R3021:Smchd1'
ID 257756
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms 4931400A14Rik, MommeD1
Accession Numbers
Essential gene? Probably essential (E-score: 0.842) question?
Stock # R3021 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71344489-71475343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 71387098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1217 (S1217R)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect possibly damaging
Transcript: ENSMUST00000127430
AA Change: S1217R

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: S1217R

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195774
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6v1c1 T C 15: 38,689,216 V307A possibly damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Ccdc85a T C 11: 28,576,894 E210G possibly damaging Het
Dennd1c C T 17: 57,074,180 probably null Het
Eng T C 2: 32,678,568 V474A probably damaging Het
Fam114a2 T C 11: 57,499,799 D303G probably benign Het
Fat1 T A 8: 45,044,011 C4178S probably damaging Het
Gm13119 T A 4: 144,361,799 M55K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Inpp4b A T 8: 81,902,838 E267D possibly damaging Het
Itch A G 2: 155,209,126 K578E possibly damaging Het
Mttp T C 3: 138,111,703 M444V probably benign Het
Olfr444 T C 6: 42,956,184 S229P possibly damaging Het
Pgm3 A T 9: 86,567,535 V144E possibly damaging Het
Ppp3cb A T 14: 20,523,853 Y271* probably null Het
Ptk2b A T 14: 66,178,183 probably null Het
Rdh1 G A 10: 127,760,208 V91M possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smad2 T G 18: 76,262,632 S47R probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
Dry_tortugas UTSW 17 71440956 missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
R8948:Smchd1 UTSW 17 71436772 missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71448757 missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71394715 critical splice donor site probably null
R9054:Smchd1 UTSW 17 71363022 nonsense probably null
R9141:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9169:Smchd1 UTSW 17 71415664 missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71365089 missense probably benign 0.05
R9368:Smchd1 UTSW 17 71387076 missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71411848 missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71394796 missense probably benign 0.27
R9426:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9491:Smchd1 UTSW 17 71360025 critical splice donor site probably null
R9511:Smchd1 UTSW 17 71443904 missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGAGCCTGCATCTCTAG -3'
(R):5'- ATTCCCTGCCACTGAAAGAAG -3'

Sequencing Primer
(F):5'- TCTAGCTCTTCCCAGGGAGACAG -3'
(R):5'- GGTTCAGTCTGTTACCCC -3'
Posted On 2015-01-11