Mutagenetix > Incidental Mutation

Incidental Mutation 'R3021:Smad2'

257757

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Madr2, Madh2, Smad 2, 7120426M23Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3021 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76374651-76444034 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 76395703 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 47 (S47R)

Ref Sequence

ENSEMBL: ENSMUSP00000132851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably damaging
Transcript: ENSMUST00000025453
AA Change: S47R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000091831
AA Change: S47R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113930
AA Change: S47R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165084
AA Change: S47R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168423
AA Change: S47R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171256
AA Change: S47R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: S47R

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp6v1c1	T	C	15: 38,689,460 (GRCm39)	V307A	possibly damaging	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Ccdc85a	T	C	11: 28,526,894 (GRCm39)	E210G	possibly damaging	Het
Dennd1c	C	T	17: 57,381,180 (GRCm39)		probably null	Het
Eng	T	C	2: 32,568,580 (GRCm39)	V474A	probably damaging	Het
Fam114a2	T	C	11: 57,390,625 (GRCm39)	D303G	probably benign	Het
Fat1	T	A	8: 45,497,048 (GRCm39)	C4178S	probably damaging	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Inpp4b	A	T	8: 82,629,467 (GRCm39)	E267D	possibly damaging	Het
Itch	A	G	2: 155,051,046 (GRCm39)	K578E	possibly damaging	Het
Mttp	T	C	3: 137,817,464 (GRCm39)	M444V	probably benign	Het
Or2a56	T	C	6: 42,933,118 (GRCm39)	S229P	possibly damaging	Het
Pgm3	A	T	9: 86,449,588 (GRCm39)	V144E	possibly damaging	Het
Ppp3cb	A	T	14: 20,573,921 (GRCm39)	Y271*	probably null	Het
Pramel31	T	A	4: 144,088,369 (GRCm39)	M55K	probably damaging	Het
Ptk2b	A	T	14: 66,415,632 (GRCm39)		probably null	Het
Rdh1	G	A	10: 127,596,077 (GRCm39)	V91M	possibly damaging	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Smchd1	G	T	17: 71,694,093 (GRCm39)	S1217R	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,509,906 (GRCm39)		probably null	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76,431,566 (GRCm39)	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76,432,846 (GRCm39)	splice site	probably benign
IGL01295:Smad2	APN	18	76,435,501 (GRCm39)	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76,432,965 (GRCm39)	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76,395,555 (GRCm39)	intron	probably benign
IGL02881:Smad2	APN	18	76,432,851 (GRCm39)	splice site	probably null
IGL02977:Smad2	APN	18	76,422,235 (GRCm39)	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76,395,692 (GRCm39)	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76,422,108 (GRCm39)	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76,395,623 (GRCm39)	missense	probably benign
R0570:Smad2	UTSW	18	76,422,250 (GRCm39)	splice site	probably benign
R0624:Smad2	UTSW	18	76,433,064 (GRCm39)	missense	probably damaging	1.00
R1573:Smad2	UTSW	18	76,395,657 (GRCm39)	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76,395,776 (GRCm39)	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76,421,155 (GRCm39)	nonsense	probably null
R2213:Smad2	UTSW	18	76,437,697 (GRCm39)	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76,421,008 (GRCm39)	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76,435,663 (GRCm39)	missense	probably benign	0.23
R5253:Smad2	UTSW	18	76,421,124 (GRCm39)	missense	probably damaging	1.00
R5290:Smad2	UTSW	18	76,395,795 (GRCm39)	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76,433,046 (GRCm39)	missense	probably damaging	1.00
R6294:Smad2	UTSW	18	76,422,233 (GRCm39)	missense	probably benign	0.31
R6879:Smad2	UTSW	18	76,395,725 (GRCm39)	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76,421,151 (GRCm39)	missense	probably damaging	1.00
R7503:Smad2	UTSW	18	76,419,956 (GRCm39)	missense	probably benign
R7757:Smad2	UTSW	18	76,421,084 (GRCm39)	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76,420,022 (GRCm39)	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76,395,573 (GRCm39)	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76,395,573 (GRCm39)	missense	possibly damaging	0.87
R9184:Smad2	UTSW	18	76,422,171 (GRCm39)	missense	probably benign	0.00
Z1177:Smad2	UTSW	18	76,421,074 (GRCm39)	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76,421,073 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTTGGTAGCATATTGAAATCCC -3'
(R):5'- ACTTTAATAACCACCCTACTCTGTG -3'

Sequencing Primer
(F):5'- AGATTTACCGGGCTTTTTCTGAG -3'
(R):5'- ACCCTACTCTGTGCAGATGAAGTG -3'

Posted On

2015-01-11