Mutagenetix > Incidental Mutation

Incidental Mutation 'R2984:Chil4'

257762

Institutional Source

Beutler Lab

Gene Symbol

Chil4

Ensembl Gene

ENSMUSG00000063779

Gene Name

chitinase-like 4

Synonyms

Ym2, Chi3l4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2984 (G1)

Quality Score

145

Status

Not validated

Chromosome

Chromosomal Location

106201490-106219507 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 106203727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 284 (P284S)

Ref Sequence

ENSEMBL: ENSMUSP00000080851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082219]

AlphaFold

Q91Z98

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082219
AA Change: P284S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: P284S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	1.77e-132	SMART

Meta Mutation Damage Score

0.6164

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	A	G	4: 56,744,531	I353V	probably benign	Het
Csmd1	C	A	8: 15,953,782	G2591C	probably damaging	Het
Lnx1	A	T	5: 74,685,422	C122*	probably null	Het
Lrp2	A	T	2: 69,425,814		probably null	Het
Ncf4	A	G	15: 78,262,320	K317E	probably benign	Het
Olfr463	C	T	11: 87,893,746	M59I	possibly damaging	Het
Pafah2	A	G	4: 134,411,871	E196G	possibly damaging	Het
Pkhd1	T	C	1: 20,222,961	N2812D	possibly damaging	Het
Sf3a3	A	T	4: 124,718,409	K153M	probably damaging	Het
Tex2	C	A	11: 106,546,663		probably null	Het
Tnxb	C	T	17: 34,678,662	Q804*	probably null	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het

Other mutations in Chil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Chil4	APN	3	106201797	missense	probably benign
IGL02457:Chil4	APN	3	106214399	missense	probably benign
R1087:Chil4	UTSW	3	106210565	missense	probably benign	0.01
R1398:Chil4	UTSW	3	106219509	splice site	probably null
R1503:Chil4	UTSW	3	106206034	missense	probably benign
R1553:Chil4	UTSW	3	106203690	missense	probably benign	0.02
R1806:Chil4	UTSW	3	106210643	splice site	probably benign
R1873:Chil4	UTSW	3	106206098	missense	probably benign	0.00
R2069:Chil4	UTSW	3	106219455	missense	probably benign	0.16
R2100:Chil4	UTSW	3	106214347	missense	probably benign
R2370:Chil4	UTSW	3	106214300	nonsense	probably null
R2985:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R3522:Chil4	UTSW	3	106203740	missense	probably benign	0.08
R3919:Chil4	UTSW	3	106202532	missense	probably benign	0.00
R4033:Chil4	UTSW	3	106214449	missense	probably damaging	1.00
R4181:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4184:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4301:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4347:Chil4	UTSW	3	106202828	missense	probably benign
R4391:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4395:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4418:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4483:Chil4	UTSW	3	106214362	missense	probably damaging	1.00
R4544:Chil4	UTSW	3	106210606	missense	probably damaging	0.97
R4887:Chil4	UTSW	3	106204144	missense	probably benign	0.01
R4949:Chil4	UTSW	3	106206092	missense	possibly damaging	0.83
R5076:Chil4	UTSW	3	106202597	missense	probably damaging	1.00
R5146:Chil4	UTSW	3	106202834	missense	probably benign	0.18
R5254:Chil4	UTSW	3	106219452	missense	probably benign	0.00
R5521:Chil4	UTSW	3	106203697	missense	possibly damaging	0.50
R5790:Chil4	UTSW	3	106202578	missense	probably benign	0.00
R5883:Chil4	UTSW	3	106210570	missense	possibly damaging	0.48
R6010:Chil4	UTSW	3	106214395	missense	probably damaging	1.00
R6257:Chil4	UTSW	3	106204096	missense	possibly damaging	0.84
R6269:Chil4	UTSW	3	106204171	missense	probably damaging	1.00
R6602:Chil4	UTSW	3	106210590	missense	probably benign	0.00
R7113:Chil4	UTSW	3	106202767	missense	probably damaging	1.00
R7113:Chil4	UTSW	3	106214348	missense	probably benign
R7188:Chil4	UTSW	3	106204159	missense	probably damaging	1.00
R7980:Chil4	UTSW	3	106202744	missense	probably damaging	1.00
R8810:Chil4	UTSW	3	106201805	missense	probably damaging	0.99
R9300:Chil4	UTSW	3	106202558	missense	probably benign	0.10
R9307:Chil4	UTSW	3	106204066	critical splice donor site	probably null
R9529:Chil4	UTSW	3	106211340	missense	probably damaging	1.00
X0067:Chil4	UTSW	3	106206034	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATGTTGTATCTGCTTAGGAAGAG -3'
(R):5'- TTCACACAATTTGAGATACAAGAGGGG -3'

Sequencing Primer
(F):5'- TCTGCTTAGGAAGAGTACATACTG -3'
(R):5'- AGGGGAGAACTAACCTATATAAACAC -3'

Posted On

2015-01-11