Incidental Mutation 'R2984:Sf3a3'
ID 257764
Institutional Source Beutler Lab
Gene Symbol Sf3a3
Ensembl Gene ENSMUSG00000028902
Gene Name splicing factor 3a, subunit 3
Synonyms 4930512K19Rik, 60kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R2984 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 124714776-124732460 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 124718409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 153 (K153M)
Ref Sequence ENSEMBL: ENSMUSP00000030734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030734]
AlphaFold Q9D554
Predicted Effect probably damaging
Transcript: ENSMUST00000030734
AA Change: K153M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030734
Gene: ENSMUSG00000028902
AA Change: K153M

DomainStartEndE-ValueType
Pfam:SF3a60_bindingd 74 100 3e-19 PFAM
Pfam:SF3A3 129 207 7.9e-27 PFAM
Pfam:Telomere_Sde2_2 244 303 3.1e-31 PFAM
low complexity region 354 377 N/A INTRINSIC
ZnF_C2H2 406 431 9.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154712
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 3 of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer includes subunits 1, 2 and 3 and is necessary for the in vitro conversion of 15S U2 snRNP into an active 17S particle that performs pre-mRNA splicing. Subunit 3 interacts with subunit 1 through its amino-terminus while the zinc finger domain of subunit 3 plays a role in its binding to the 15S U2 snRNP. This gene has a pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a A G 4: 56,744,531 I353V probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Csmd1 C A 8: 15,953,782 G2591C probably damaging Het
Lnx1 A T 5: 74,685,422 C122* probably null Het
Lrp2 A T 2: 69,425,814 probably null Het
Ncf4 A G 15: 78,262,320 K317E probably benign Het
Olfr463 C T 11: 87,893,746 M59I possibly damaging Het
Pafah2 A G 4: 134,411,871 E196G possibly damaging Het
Pkhd1 T C 1: 20,222,961 N2812D possibly damaging Het
Tex2 C A 11: 106,546,663 probably null Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Other mutations in Sf3a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
IGL01623:Sf3a3 APN 4 124718343 missense possibly damaging 0.93
PIT4495001:Sf3a3 UTSW 4 124728320 missense probably damaging 1.00
R0070:Sf3a3 UTSW 4 124714955 missense probably benign 0.04
R1441:Sf3a3 UTSW 4 124725142 missense probably damaging 0.99
R1858:Sf3a3 UTSW 4 124729495 missense probably damaging 1.00
R1928:Sf3a3 UTSW 4 124722093 missense possibly damaging 0.56
R1943:Sf3a3 UTSW 4 124715901 missense possibly damaging 0.95
R2101:Sf3a3 UTSW 4 124718343 missense possibly damaging 0.93
R3434:Sf3a3 UTSW 4 124725077 missense possibly damaging 0.95
R4366:Sf3a3 UTSW 4 124725139 missense probably benign
R4711:Sf3a3 UTSW 4 124728181 missense probably benign 0.01
R5032:Sf3a3 UTSW 4 124725166 missense probably benign 0.17
R5464:Sf3a3 UTSW 4 124728240 critical splice donor site probably null
R5607:Sf3a3 UTSW 4 124714953 missense probably damaging 1.00
R5997:Sf3a3 UTSW 4 124722058 missense probably damaging 0.99
R6166:Sf3a3 UTSW 4 124723384 intron probably benign
R7030:Sf3a3 UTSW 4 124722880 missense probably damaging 1.00
R7038:Sf3a3 UTSW 4 124728426 missense probably benign 0.16
R7157:Sf3a3 UTSW 4 124722900 missense probably damaging 0.98
R7184:Sf3a3 UTSW 4 124714979 missense probably benign 0.10
R7250:Sf3a3 UTSW 4 124722915 missense probably benign 0.03
R9212:Sf3a3 UTSW 4 124728128 missense possibly damaging 0.67
Z1176:Sf3a3 UTSW 4 124714901 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGTCATTTGATGAGAGCAGAG -3'
(R):5'- TGAGCCATCTTACTAGCCCC -3'

Sequencing Primer
(F):5'- CATTAAGTGACGGGCTACCTCGTAG -3'
(R):5'- CCGACCCTGACTTTCTTTATAAATAG -3'
Posted On 2015-01-11