Incidental Mutation 'R2985:Bahd1'
ID257775
Institutional Source Beutler Lab
Gene Symbol Bahd1
Ensembl Gene ENSMUSG00000040007
Gene Namebromo adjacent homology domain containing 1
SynonymsLOC228536
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2985 (G1)
Quality Score166
Status Not validated
Chromosome2
Chromosomal Location118900377-118924528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118922523 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 757 (R757H)
Ref Sequence ENSEMBL: ENSMUSP00000043130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036578] [ENSMUST00000099546] [ENSMUST00000110837]
Predicted Effect probably damaging
Transcript: ENSMUST00000036578
AA Change: R757H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043130
Gene: ENSMUSG00000040007
AA Change: R757H

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 117 141 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 564 579 N/A INTRINSIC
BAH 616 771 1.17e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099546
SMART Domains Protein: ENSMUSP00000099579
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 139 365 1.6e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110837
SMART Domains Protein: ENSMUSP00000106461
Gene: ENSMUSG00000074916

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:Sulfotransfer_2 135 340 1.5e-41 PFAM
Meta Mutation Damage Score 0.8159 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc83 A G 7: 90,236,367 probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cul1 T A 6: 47,502,507 F236I probably damaging Het
Etl4 T C 2: 20,781,849 V470A probably damaging Het
Fndc1 T C 17: 7,756,323 E1428G possibly damaging Het
Gal3st1 A G 11: 3,998,618 Y275C probably damaging Het
Jakmip2 G A 18: 43,571,181 T366I possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Obscn A G 11: 59,133,089 F585S probably damaging Het
Olfr923 G A 9: 38,828,110 V140I probably benign Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Pcdha9 A G 18: 36,998,202 N108S possibly damaging Het
Pkd1l2 T C 8: 117,065,551 S501G probably benign Het
Pls1 G A 9: 95,785,582 T91M possibly damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Trpm5 G T 7: 143,082,938 L421I probably damaging Het
Ttn A T 2: 76,744,274 V25425E probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Other mutations in Bahd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Bahd1 APN 2 118917205 missense probably benign 0.01
IGL02425:Bahd1 APN 2 118919164 missense probably benign 0.00
IGL02548:Bahd1 APN 2 118917045 missense possibly damaging 0.79
IGL03024:Bahd1 APN 2 118916116 missense probably damaging 1.00
R0932:Bahd1 UTSW 2 118915927 missense probably damaging 1.00
R1737:Bahd1 UTSW 2 118915923 missense probably damaging 1.00
R2845:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2846:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R2899:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2900:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2966:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R2986:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3017:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3018:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3019:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3020:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3021:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3033:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3040:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R3431:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3432:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R3617:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4319:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4394:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4395:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4418:Bahd1 UTSW 2 118922523 missense probably damaging 1.00
R4456:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4462:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R4484:Bahd1 UTSW 2 118916406 missense probably damaging 1.00
R5537:Bahd1 UTSW 2 118915980 missense probably damaging 0.96
R5556:Bahd1 UTSW 2 118916270 missense probably damaging 1.00
R6490:Bahd1 UTSW 2 118917138 missense probably benign 0.01
R6736:Bahd1 UTSW 2 118915975 missense possibly damaging 0.54
R7604:Bahd1 UTSW 2 118916310 missense probably benign
Z1176:Bahd1 UTSW 2 118922403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCAGCTCAGTGTTAGG -3'
(R):5'- GCTGAGGGTCTAGATACCTTTCTC -3'

Sequencing Primer
(F):5'- GGAAGAAATTGGTTTCCTTGAAAGC -3'
(R):5'- GAGGGTCTAGATACCTTTCTCATATC -3'
Posted On2015-01-11