Incidental Mutation 'R0325:Papola'
ID25778
Institutional Source Beutler Lab
Gene Symbol Papola
Ensembl Gene ENSMUSG00000021111
Gene Namepoly (A) polymerase alpha
SynonymsPapIII, Plap
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location105784694-105838944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105807193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 157 (I157N)
Ref Sequence ENSEMBL: ENSMUSP00000126275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000164326] [ENSMUST00000166329] [ENSMUST00000166735] [ENSMUST00000168186] [ENSMUST00000169938] [ENSMUST00000170002] [ENSMUST00000170540]
Predicted Effect probably damaging
Transcript: ENSMUST00000021535
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109901
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163473
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163805
Predicted Effect probably benign
Transcript: ENSMUST00000164326
SMART Domains Protein: ENSMUSP00000125818
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 64 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165584
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166498
Predicted Effect probably damaging
Transcript: ENSMUST00000166735
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128908
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 283 9.4e-73 PFAM
Pfam:NTP_transf_2 72 175 5.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168186
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169524
SMART Domains Protein: ENSMUSP00000130798
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 95 5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169938
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170002
AA Change: I157N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111
AA Change: I157N

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172040
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Papola
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Papola APN 12 105809597 nonsense probably null
IGL02197:Papola APN 12 105829183 missense possibly damaging 0.90
IGL02511:Papola APN 12 105809345 missense probably damaging 0.99
IGL02608:Papola APN 12 105809559 missense probably damaging 1.00
IGL03081:Papola APN 12 105818855 missense probably damaging 1.00
IGL03378:Papola APN 12 105809433 critical splice donor site probably null
IGL03401:Papola APN 12 105829122 missense probably benign 0.19
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0372:Papola UTSW 12 105818838 missense probably benign 0.05
R1553:Papola UTSW 12 105820410 missense probably benign 0.30
R1746:Papola UTSW 12 105807209 missense probably benign 0.12
R1954:Papola UTSW 12 105828273 unclassified probably null
R2424:Papola UTSW 12 105827052 missense probably benign 0.02
R4133:Papola UTSW 12 105799658 missense possibly damaging 0.83
R4156:Papola UTSW 12 105800751 critical splice donor site probably null
R4718:Papola UTSW 12 105820448 missense possibly damaging 0.72
R4814:Papola UTSW 12 105799653 missense probably damaging 1.00
R5115:Papola UTSW 12 105826960 missense probably benign 0.08
R5237:Papola UTSW 12 105826960 missense probably benign 0.08
R5372:Papola UTSW 12 105827050 missense probably benign 0.00
R5420:Papola UTSW 12 105806495 missense possibly damaging 0.95
R5430:Papola UTSW 12 105809584 missense probably damaging 1.00
R5831:Papola UTSW 12 105823600 missense probably benign 0.01
R5944:Papola UTSW 12 105812385 missense possibly damaging 0.87
R5956:Papola UTSW 12 105811041 missense probably damaging 1.00
R6143:Papola UTSW 12 105826960 missense probably benign 0.08
R6193:Papola UTSW 12 105820346 missense probably benign 0.42
R6413:Papola UTSW 12 105806504 start gained probably benign
R6490:Papola UTSW 12 105804937 missense probably benign 0.40
R6649:Papola UTSW 12 105812307 missense possibly damaging 0.72
R6891:Papola UTSW 12 105809691 unclassified probably benign
R7147:Papola UTSW 12 105808638 start gained probably benign
R7177:Papola UTSW 12 105809531 missense possibly damaging 0.95
R7178:Papola UTSW 12 105807184 missense probably damaging 1.00
R7256:Papola UTSW 12 105809345 missense probably damaging 0.99
R7583:Papola UTSW 12 105811045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGTGTGAACAGCCACATTTCC -3'
(R):5'- TGCAGTAGCCTCAGTCCTAAGTCC -3'

Sequencing Primer
(F):5'- tggaaagtagaggcaggagg -3'
(R):5'- CCACTTCCGCTTAAAGAGTTAG -3'
Posted On2013-04-16