Incidental Mutation 'R2986:Bbs4'
ID257802
Institutional Source Beutler Lab
Gene Symbol Bbs4
Ensembl Gene ENSMUSG00000025235
Gene NameBardet-Biedl syndrome 4 (human)
SynonymsD9Ertd464e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R2986 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59321990-59353508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59341195 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 75 (L75P)
Ref Sequence ENSEMBL: ENSMUSP00000026265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026265]
Predicted Effect probably damaging
Transcript: ENSMUST00000026265
AA Change: L75P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026265
Gene: ENSMUSG00000025235
AA Change: L75P

DomainStartEndE-ValueType
TPR 67 100 1.64e1 SMART
TPR 101 134 1.14e1 SMART
TPR 135 168 5.19e-3 SMART
TPR 169 201 3.67e-3 SMART
TPR 202 235 9.68e-3 SMART
TPR 270 303 1.26e-1 SMART
TPR 304 337 2.38e-2 SMART
TPR 338 371 1.64e1 SMART
low complexity region 490 504 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214832
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity and polyphagia after weaning, retinal degeneration, male infertility, absence of sperm cell flagella, renal abnormalities, impaired olfaction, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,520,517 C364F probably damaging Het
AI661453 T A 17: 47,466,772 C474* probably null Het
Arhgap18 A G 10: 26,854,907 T122A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cenpl C T 1: 161,083,467 probably benign Het
Cnnm4 G A 1: 36,472,372 R227H possibly damaging Het
Eif4g2 T C 7: 111,078,483 E141G probably damaging Het
Fat3 A G 9: 15,992,128 C3024R probably damaging Het
Gss T C 2: 155,587,443 D43G probably benign Het
Hmcn2 A T 2: 31,360,998 D824V probably damaging Het
Slc15a1 C T 14: 121,489,809 D116N probably benign Het
Slc34a1 A G 13: 55,403,329 D190G probably benign Het
Ttll11 G A 2: 35,817,738 S519L probably benign Het
Uhrf1bp1l T A 10: 89,806,069 V1034E probably benign Het
Wdr49 T C 3: 75,382,040 M184V probably benign Het
Zfp384 T A 6: 125,024,896 V113E possibly damaging Het
Other mutations in Bbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Bbs4 APN 9 59324065 missense probably benign 0.00
IGL01360:Bbs4 APN 9 59339848 missense possibly damaging 0.89
IGL02005:Bbs4 APN 9 59336355 splice site probably benign
IGL02150:Bbs4 APN 9 59336368 missense probably benign
IGL02278:Bbs4 APN 9 59341168 missense possibly damaging 0.64
IGL02402:Bbs4 APN 9 59330446 missense probably benign 0.41
IGL02593:Bbs4 APN 9 59328597 missense probably damaging 0.99
IGL03328:Bbs4 APN 9 59344118 missense probably damaging 1.00
R0964:Bbs4 UTSW 9 59322976 makesense probably null
R1298:Bbs4 UTSW 9 59339813 missense probably damaging 1.00
R1944:Bbs4 UTSW 9 59330415 splice site probably null
R4118:Bbs4 UTSW 9 59330425 missense possibly damaging 0.90
R4701:Bbs4 UTSW 9 59323519 missense probably benign
R6930:Bbs4 UTSW 9 59323481 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACATAGCAAACATCTGGCTG -3'
(R):5'- AATCTCAGTTAGCTTACTACGGGC -3'

Sequencing Primer
(F):5'- CATAGCAAACATCTGGCTGATATAG -3'
(R):5'- AGTTAGCTTACTACGGGCTTCCC -3'
Posted On2015-01-11