Incidental Mutation 'R2986:Arhgap18'
ID257804
Institutional Source Beutler Lab
Gene Symbol Arhgap18
Ensembl Gene ENSMUSG00000039031
Gene NameRho GTPase activating protein 18
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2986 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location26753421-26918648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26854907 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 122 (T122A)
Ref Sequence ENSEMBL: ENSMUSP00000135030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039557] [ENSMUST00000135866] [ENSMUST00000176060]
Predicted Effect probably benign
Transcript: ENSMUST00000039557
AA Change: T194A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044834
Gene: ENSMUSG00000039031
AA Change: T194A

DomainStartEndE-ValueType
low complexity region 100 114 N/A INTRINSIC
RhoGAP 340 520 8.99e-42 SMART
coiled coil region 535 557 N/A INTRINSIC
Blast:RhoGAP 572 613 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135866
SMART Domains Protein: ENSMUSP00000135783
Gene: ENSMUSG00000039031

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176060
AA Change: T122A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135030
Gene: ENSMUSG00000039031
AA Change: T122A

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,520,517 C364F probably damaging Het
AI661453 T A 17: 47,466,772 C474* probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Bbs4 A G 9: 59,341,195 L75P probably damaging Het
Cenpl C T 1: 161,083,467 probably benign Het
Cnnm4 G A 1: 36,472,372 R227H possibly damaging Het
Eif4g2 T C 7: 111,078,483 E141G probably damaging Het
Fat3 A G 9: 15,992,128 C3024R probably damaging Het
Gss T C 2: 155,587,443 D43G probably benign Het
Hmcn2 A T 2: 31,360,998 D824V probably damaging Het
Slc15a1 C T 14: 121,489,809 D116N probably benign Het
Slc34a1 A G 13: 55,403,329 D190G probably benign Het
Ttll11 G A 2: 35,817,738 S519L probably benign Het
Uhrf1bp1l T A 10: 89,806,069 V1034E probably benign Het
Wdr49 T C 3: 75,382,040 M184V probably benign Het
Zfp384 T A 6: 125,024,896 V113E possibly damaging Het
Other mutations in Arhgap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Arhgap18 APN 10 26880748 missense possibly damaging 0.75
IGL02393:Arhgap18 APN 10 26877183 missense probably benign 0.07
IGL03368:Arhgap18 APN 10 26772693 missense possibly damaging 0.60
Half_pint UTSW 10 26772698 critical splice donor site probably null
R0698:Arhgap18 UTSW 10 26912629 missense probably damaging 1.00
R1456:Arhgap18 UTSW 10 26916440 missense probably benign 0.29
R1532:Arhgap18 UTSW 10 26860722 missense possibly damaging 0.69
R1768:Arhgap18 UTSW 10 26887861 missense probably damaging 1.00
R1768:Arhgap18 UTSW 10 26887862 missense probably damaging 1.00
R1793:Arhgap18 UTSW 10 26860736 unclassified probably benign
R1867:Arhgap18 UTSW 10 26846030 missense probably damaging 0.99
R2020:Arhgap18 UTSW 10 26854904 missense probably benign
R2049:Arhgap18 UTSW 10 26849942 missense probably benign 0.00
R2056:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2058:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R3027:Arhgap18 UTSW 10 26846096 missense probably benign
R5103:Arhgap18 UTSW 10 26869982 missense probably damaging 1.00
R5468:Arhgap18 UTSW 10 26912671 missense probably damaging 0.99
R5532:Arhgap18 UTSW 10 26846108 missense possibly damaging 0.56
R5710:Arhgap18 UTSW 10 26860733 unclassified probably null
R6019:Arhgap18 UTSW 10 26860650 missense probably damaging 0.98
R6190:Arhgap18 UTSW 10 26846035 start codon destroyed probably null 0.22
R6346:Arhgap18 UTSW 10 26846065 missense probably damaging 1.00
R6438:Arhgap18 UTSW 10 26772698 critical splice donor site probably null
R6572:Arhgap18 UTSW 10 26846416 intron probably null
R6799:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R6844:Arhgap18 UTSW 10 26772686 missense probably benign 0.04
R7051:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7084:Arhgap18 UTSW 10 26872738 missense possibly damaging 0.77
R7727:Arhgap18 UTSW 10 26870011 missense possibly damaging 0.83
R8046:Arhgap18 UTSW 10 26887857 missense probably damaging 0.98
R8252:Arhgap18 UTSW 10 26854936 missense probably benign 0.00
R8392:Arhgap18 UTSW 10 26845940 missense probably benign 0.38
Z1088:Arhgap18 UTSW 10 26850004 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GTCACTGTGGCACTCTGTTC -3'
(R):5'- GCATGCCACTGTGAATATGATAAG -3'

Sequencing Primer
(F):5'- CGCTGCCTGTGACGTGTATAAG -3'
(R):5'- GCCACTGTGAATATGATAAGCATTC -3'
Posted On2015-01-11