Incidental Mutation 'R2986:Slc15a1'
ID257807
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Namesolute carrier family 15 (oligopeptide transporter), member 1
SynonymsPECT1, PEPT1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2986 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121459621-121505252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121489809 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 116 (D116N)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
Predicted Effect probably benign
Transcript: ENSMUST00000088386
AA Change: D116N

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: D116N

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227372
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,520,517 C364F probably damaging Het
AI661453 T A 17: 47,466,772 C474* probably null Het
Arhgap18 A G 10: 26,854,907 T122A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Bbs4 A G 9: 59,341,195 L75P probably damaging Het
Cenpl C T 1: 161,083,467 probably benign Het
Cnnm4 G A 1: 36,472,372 R227H possibly damaging Het
Eif4g2 T C 7: 111,078,483 E141G probably damaging Het
Fat3 A G 9: 15,992,128 C3024R probably damaging Het
Gss T C 2: 155,587,443 D43G probably benign Het
Hmcn2 A T 2: 31,360,998 D824V probably damaging Het
Slc34a1 A G 13: 55,403,329 D190G probably benign Het
Ttll11 G A 2: 35,817,738 S519L probably benign Het
Uhrf1bp1l T A 10: 89,806,069 V1034E probably benign Het
Wdr49 T C 3: 75,382,040 M184V probably benign Het
Zfp384 T A 6: 125,024,896 V113E possibly damaging Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8284:Slc15a1 UTSW 14 121489863 missense probably benign 0.01
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8408:Slc15a1 UTSW 14 121478116 missense possibly damaging 0.91
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACAGTGAGCAGACATTAGG -3'
(R):5'- AACATGATTGGGCTCTTCAAAGC -3'

Sequencing Primer
(F):5'- CAGTGAGCAGACATTAGGATGGG -3'
(R):5'- GCTCTTCAAAGCTCTGTAGGAG -3'
Posted On2015-01-11