Incidental Mutation 'R2987:Olfml2a'
ID257811
Institutional Source Beutler Lab
Gene Symbol Olfml2a
Ensembl Gene ENSMUSG00000046618
Gene Nameolfactomedin-like 2A
Synonymsphotomedin-1, 4932431K08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location38931978-38963753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38947294 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 150 (V150M)
Ref Sequence ENSEMBL: ENSMUSP00000058761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057279]
Predicted Effect probably damaging
Transcript: ENSMUST00000057279
AA Change: V150M

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058761
Gene: ENSMUSG00000046618
AA Change: V150M

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
internal_repeat_1 39 66 2.55e-7 PROSPERO
internal_repeat_1 78 105 2.55e-7 PROSPERO
coiled coil region 168 189 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
low complexity region 252 271 N/A INTRINSIC
low complexity region 302 320 N/A INTRINSIC
low complexity region 367 407 N/A INTRINSIC
OLF 426 681 8.73e-69 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Olfml2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Olfml2a APN 2 38947214 critical splice acceptor site probably null
IGL02367:Olfml2a APN 2 38954668 missense probably benign 0.15
IGL03140:Olfml2a APN 2 38947291 missense probably damaging 1.00
R0559:Olfml2a UTSW 2 38959820 missense probably damaging 1.00
R0781:Olfml2a UTSW 2 38959753 missense probably damaging 0.99
R1110:Olfml2a UTSW 2 38959753 missense probably damaging 0.99
R1187:Olfml2a UTSW 2 38959813 missense probably damaging 1.00
R1626:Olfml2a UTSW 2 38951263 missense probably damaging 1.00
R1634:Olfml2a UTSW 2 38960219 missense probably benign 0.03
R2127:Olfml2a UTSW 2 38941687 missense probably damaging 1.00
R4428:Olfml2a UTSW 2 38941743 missense probably damaging 0.96
R4564:Olfml2a UTSW 2 38960294 missense probably benign 0.40
R4609:Olfml2a UTSW 2 38957721 missense probably damaging 0.98
R4667:Olfml2a UTSW 2 38949010 missense probably damaging 0.99
R4703:Olfml2a UTSW 2 38951238 missense probably damaging 1.00
R4827:Olfml2a UTSW 2 38960021 missense probably damaging 1.00
R5588:Olfml2a UTSW 2 38960035 missense probably damaging 1.00
R5879:Olfml2a UTSW 2 38960230 missense probably damaging 1.00
R6063:Olfml2a UTSW 2 38951143 missense probably benign 0.03
R6484:Olfml2a UTSW 2 38959768 missense probably damaging 1.00
R6788:Olfml2a UTSW 2 38960226 nonsense probably null
R7345:Olfml2a UTSW 2 38960127 missense probably damaging 1.00
R7474:Olfml2a UTSW 2 38960261 missense probably damaging 0.98
R8073:Olfml2a UTSW 2 38957754 missense probably damaging 1.00
Z1177:Olfml2a UTSW 2 38960284 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGGAGTCCAAGTAGCCACTG -3'
(R):5'- GATGTTAGCAGCATCCCTCCTC -3'

Sequencing Primer
(F):5'- TCCAAGTAGCCACTGTGAGG -3'
(R):5'- CCTCCTCTCCCCGCAAG -3'
Posted On2015-01-11