Incidental Mutation 'R2987:Ebna1bp2'
ID257815
Institutional Source Beutler Lab
Gene Symbol Ebna1bp2
Ensembl Gene ENSMUSG00000028729
Gene NameEBNA1 binding protein 2
Synonymsp40, Nobp, 1810014B19Rik, Ebp2, B830003A16Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118620799-118627776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118620936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000030501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030501] [ENSMUST00000071972] [ENSMUST00000081921] [ENSMUST00000147373]
Predicted Effect probably damaging
Transcript: ENSMUST00000030501
AA Change: D2G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030501
Gene: ENSMUSG00000028729
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Ebp2 18 298 2.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071972
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130219
Predicted Effect probably benign
Transcript: ENSMUST00000147373
SMART Domains Protein: ENSMUSP00000114372
Gene: ENSMUSG00000028729

DomainStartEndE-ValueType
Pfam:Ebp2 13 187 4.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149837
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Ebna1bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ebna1bp2 APN 4 118625821 missense probably damaging 1.00
IGL02390:Ebna1bp2 APN 4 118621497 missense possibly damaging 0.46
R1451:Ebna1bp2 UTSW 4 118621072 splice site probably null
R1713:Ebna1bp2 UTSW 4 118625684 missense possibly damaging 0.46
R5865:Ebna1bp2 UTSW 4 118621135 unclassified probably benign
R5889:Ebna1bp2 UTSW 4 118621423 missense probably damaging 1.00
R6761:Ebna1bp2 UTSW 4 118623361 nonsense probably null
R6806:Ebna1bp2 UTSW 4 118620977 missense probably benign 0.01
R7014:Ebna1bp2 UTSW 4 118623378 nonsense probably null
R7075:Ebna1bp2 UTSW 4 118622102 missense probably benign 0.00
R7123:Ebna1bp2 UTSW 4 118625575 missense probably damaging 1.00
Z1176:Ebna1bp2 UTSW 4 118621146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGATCCGAAGCAATCCGG -3'
(R):5'- TAGCACGACATTGAGACCTGG -3'

Sequencing Primer
(F):5'- AAGCAATCCGGGCACGC -3'
(R):5'- ACATTGAGACCTGGCTTCAG -3'
Posted On2015-01-11