Incidental Mutation 'R2987:Sumf2'
List |< first << previous [record 19 of 23] next >> last >|
ID257817
Institutional Source Beutler Lab
Gene Symbol Sumf2
Ensembl Gene ENSMUSG00000025538
Gene Namesulfatase modifying factor 2
Synonyms2610040F05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129846986-129864050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129847084 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 30 (L30P)
Ref Sequence ENSEMBL: ENSMUSP00000126036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137357] [ENSMUST00000171300] [ENSMUST00000201874]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031402
SMART Domains Protein: ENSMUSP00000031402
Gene: ENSMUSG00000029447

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
Pfam:Cpn60_TCP1 30 527 9.9e-153 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137357
AA Change: L21P
SMART Domains Protein: ENSMUSP00000144155
Gene: ENSMUSG00000025538
AA Change: L21P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:FGE-sulfatase 25 136 6.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171300
AA Change: L30P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126036
Gene: ENSMUSG00000025538
AA Change: L30P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:FGE-sulfatase 34 299 3.9e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201414
Predicted Effect unknown
Transcript: ENSMUST00000201874
AA Change: L25P
SMART Domains Protein: ENSMUSP00000144230
Gene: ENSMUSG00000025538
AA Change: L25P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:FGE-sulfatase 29 135 3.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202466
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Sumf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Sumf2 APN 5 129854077 intron probably benign
IGL01285:Sumf2 APN 5 129849970 missense probably damaging 1.00
IGL02247:Sumf2 APN 5 129860145 missense probably damaging 0.98
IGL02348:Sumf2 APN 5 129859870 missense probably damaging 1.00
IGL03074:Sumf2 APN 5 129859833 splice site probably benign
R0105:Sumf2 UTSW 5 129849894 splice site probably benign
R0105:Sumf2 UTSW 5 129849894 splice site probably benign
R0751:Sumf2 UTSW 5 129850005 missense probably benign 0.45
R1219:Sumf2 UTSW 5 129854772 missense probably benign
R1565:Sumf2 UTSW 5 129859914 missense probably damaging 1.00
R1678:Sumf2 UTSW 5 129854716 missense possibly damaging 0.69
R1778:Sumf2 UTSW 5 129845068 unclassified probably benign
R3930:Sumf2 UTSW 5 129849979 missense probably benign 0.15
R6877:Sumf2 UTSW 5 129850026 missense probably damaging 1.00
R7060:Sumf2 UTSW 5 129854500 missense possibly damaging 0.66
R7326:Sumf2 UTSW 5 129862710 missense probably benign 0.00
R8291:Sumf2 UTSW 5 129858297 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTGTTCATTCATGGGCG -3'
(R):5'- CTGAATACCAGAAGAGACCCTG -3'

Sequencing Primer
(F):5'- TCATTCATGGGCGGGCCTG -3'
(R):5'- GCAGTTTCATGATGGCCA -3'
Posted On2015-01-11