Mutagenetix > Incidental Mutation

Incidental Mutation 'R2987:Clcn1'

257818

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, NMF355, Clc-1, nmf355

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42263619-42292690 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 42275784 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 302 (Y302C)

Ref Sequence

ENSEMBL: ENSMUSP00000031894 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]

AlphaFold

Q64347

Predicted Effect

probably damaging
Transcript: ENSMUST00000031894
AA Change: Y302C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: Y302C

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114684

SMART Domains

Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	3	254	2.6e-42	PFAM
CBS	294	344	1.3e1	SMART
low complexity region	405	429	N/A	INTRINSIC
Blast:CBS	480	524	2e-13	BLAST
low complexity region	575	597	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163936

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165780

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168660

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169024

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000170028
AA Change: T246A

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: T246A

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	T	C	5: 30,402,358 (GRCm39)	I557V	probably damaging	Het
Bag6	T	A	17: 35,364,661 (GRCm39)	L983*	probably null	Het
Dlc1	A	T	8: 37,041,306 (GRCm39)	C1308S	probably damaging	Het
Ebna1bp2	A	G	4: 118,478,133 (GRCm39)	D2G	probably damaging	Het
Exoc6b	T	A	6: 84,828,929 (GRCm39)	K485I	probably damaging	Het
Galnt3	C	T	2: 65,914,585 (GRCm39)	E611K	probably benign	Het
Gm5901	A	G	7: 105,026,507 (GRCm39)	I92V	probably benign	Het
Kcnh8	A	T	17: 53,263,763 (GRCm39)	L753F	probably benign	Het
L3mbtl4	T	C	17: 68,666,513 (GRCm39)	S14P	possibly damaging	Het
Map4k4	A	G	1: 40,025,925 (GRCm39)	H305R	probably damaging	Het
Nid1	A	T	13: 13,674,258 (GRCm39)	Y879F	probably benign	Het
Nsf	A	T	11: 103,749,869 (GRCm39)		probably null	Het
Olfml2a	G	A	2: 38,837,306 (GRCm39)	V150M	probably damaging	Het
Or51a24	A	G	7: 103,734,077 (GRCm39)	V70A	probably benign	Het
Pkhd1	A	T	1: 20,174,823 (GRCm39)	D3744E	possibly damaging	Het
Pla1a	A	T	16: 38,228,104 (GRCm39)	C258S	probably damaging	Het
Plk2	A	T	13: 110,534,243 (GRCm39)	R274S	probably benign	Het
Sumf2	T	C	5: 129,875,925 (GRCm39)	L30P	possibly damaging	Het
Synpo2	T	C	3: 122,910,622 (GRCm39)	H341R	probably damaging	Het
Trbv12-1	G	A	6: 41,090,840 (GRCm39)	E71K	probably benign	Het
Usp17lc	T	C	7: 103,067,509 (GRCm39)	V268A	probably damaging	Het
Vmn1r36	A	T	6: 66,693,700 (GRCm39)	H21Q	probably benign	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42,268,637 (GRCm39)	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42,287,606 (GRCm39)	splice site	probably benign
IGL02055:Clcn1	APN	6	42,284,489 (GRCm39)	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42,284,007 (GRCm39)	splice site	probably benign
IGL02649:Clcn1	APN	6	42,275,763 (GRCm39)	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42,263,714 (GRCm39)	splice site	probably null
IGL03148:Clcn1	APN	6	42,276,925 (GRCm39)	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42,267,037 (GRCm39)	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42,288,153 (GRCm39)	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42,288,153 (GRCm39)	missense	probably benign	0.00
Faint	UTSW	6	42,284,199 (GRCm39)	missense	probably damaging	1.00
jack_spratt	UTSW	6	42,287,515 (GRCm39)	missense	probably benign
Limitations	UTSW	6	42,286,997 (GRCm39)	missense	possibly damaging	0.79
maimed	UTSW	6	42,275,754 (GRCm39)	missense	probably damaging	1.00
stunted	UTSW	6	42,263,701 (GRCm39)	start codon destroyed	possibly damaging	0.79
R0167:Clcn1	UTSW	6	42,263,770 (GRCm39)	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42,287,074 (GRCm39)	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42,287,515 (GRCm39)	missense	probably benign
R0573:Clcn1	UTSW	6	42,289,979 (GRCm39)	splice site	probably null
R0615:Clcn1	UTSW	6	42,282,509 (GRCm39)	missense	probably damaging	1.00
R0944:Clcn1	UTSW	6	42,290,075 (GRCm39)	missense	probably benign	0.00
R1562:Clcn1	UTSW	6	42,277,169 (GRCm39)	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42,268,374 (GRCm39)	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42,290,032 (GRCm39)	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42,276,448 (GRCm39)	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42,276,448 (GRCm39)	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42,271,079 (GRCm39)	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42,276,448 (GRCm39)	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42,275,860 (GRCm39)	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42,290,925 (GRCm39)	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42,282,475 (GRCm39)	missense	probably damaging	1.00
R1865:Clcn1	UTSW	6	42,282,475 (GRCm39)	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42,268,559 (GRCm39)	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42,290,046 (GRCm39)	missense	probably damaging	0.99
R3082:Clcn1	UTSW	6	42,267,112 (GRCm39)	missense	probably damaging	0.98
R3500:Clcn1	UTSW	6	42,269,929 (GRCm39)	missense	probably damaging	0.99
R3747:Clcn1	UTSW	6	42,276,849 (GRCm39)	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42,276,849 (GRCm39)	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42,286,902 (GRCm39)	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42,267,131 (GRCm39)	splice site	probably null
R4836:Clcn1	UTSW	6	42,286,898 (GRCm39)	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42,287,922 (GRCm39)	nonsense	probably null
R5085:Clcn1	UTSW	6	42,290,814 (GRCm39)	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42,277,275 (GRCm39)	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42,275,823 (GRCm39)	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42,284,199 (GRCm39)	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42,269,900 (GRCm39)	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42,277,208 (GRCm39)	nonsense	probably null
R6175:Clcn1	UTSW	6	42,291,096 (GRCm39)	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42,290,172 (GRCm39)	missense	possibly damaging	0.82
R6394:Clcn1	UTSW	6	42,284,524 (GRCm39)	missense	possibly damaging	0.84
R7012:Clcn1	UTSW	6	42,267,542 (GRCm39)	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42,275,754 (GRCm39)	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42,284,477 (GRCm39)	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42,268,323 (GRCm39)	missense	possibly damaging	0.46
R7225:Clcn1	UTSW	6	42,270,396 (GRCm39)	missense	probably damaging	1.00
R7264:Clcn1	UTSW	6	42,275,772 (GRCm39)	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42,268,268 (GRCm39)	nonsense	probably null
R7663:Clcn1	UTSW	6	42,286,997 (GRCm39)	missense	possibly damaging	0.79
R7807:Clcn1	UTSW	6	42,287,282 (GRCm39)	splice site	probably null
R7954:Clcn1	UTSW	6	42,263,625 (GRCm39)	unclassified	probably benign
R8026:Clcn1	UTSW	6	42,284,595 (GRCm39)	critical splice donor site	probably null
R8045:Clcn1	UTSW	6	42,267,628 (GRCm39)	missense	probably damaging	1.00
R8499:Clcn1	UTSW	6	42,284,133 (GRCm39)	missense	probably damaging	1.00
R8523:Clcn1	UTSW	6	42,284,523 (GRCm39)	nonsense	probably null
R8677:Clcn1	UTSW	6	42,267,519 (GRCm39)	critical splice acceptor site	probably null
R8818:Clcn1	UTSW	6	42,282,477 (GRCm39)	missense	probably damaging	0.98
R8945:Clcn1	UTSW	6	42,263,701 (GRCm39)	start codon destroyed	possibly damaging	0.79
R9012:Clcn1	UTSW	6	42,268,567 (GRCm39)	missense	possibly damaging	0.75
R9295:Clcn1	UTSW	6	42,290,883 (GRCm39)	missense	probably benign	0.00
R9433:Clcn1	UTSW	6	42,282,494 (GRCm39)	missense	probably damaging	1.00
R9513:Clcn1	UTSW	6	42,282,462 (GRCm39)	missense	probably damaging	1.00
R9679:Clcn1	UTSW	6	42,263,753 (GRCm39)	missense	probably damaging	0.98
Z1088:Clcn1	UTSW	6	42,284,190 (GRCm39)	missense	probably damaging	1.00
Z1088:Clcn1	UTSW	6	42,277,294 (GRCm39)	missense	probably benign	0.40
Z1176:Clcn1	UTSW	6	42,284,501 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTCCATAGACAAGTATGTGAC -3'
(R):5'- GGTCTTCCTTCCCAGACAACAC -3'

Sequencing Primer
(F):5'- CTCCATAGACAAGTATGTGACTGTAG -3'
(R):5'- CACCATGCATTCTTATCTAAAGTGC -3'

Posted On

2015-01-11