Incidental Mutation 'R2987:Vmn1r36'
ID257819
Institutional Source Beutler Lab
Gene Symbol Vmn1r36
Ensembl Gene ENSMUSG00000115482
Gene Namevomeronasal 1 receptor 36
SynonymsV1rc11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R2987 (G1)
Quality Score88
Status Not validated
Chromosome6
Chromosomal Location66715257-66719168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66716716 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 21 (H21Q)
Ref Sequence ENSEMBL: ENSMUSP00000153912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177072] [ENSMUST00000226142] [ENSMUST00000226635] [ENSMUST00000226728] [ENSMUST00000226829]
Predicted Effect probably benign
Transcript: ENSMUST00000177072
AA Change: H58Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135070
Gene: ENSMUSG00000093764
AA Change: H58Q

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203829
Predicted Effect probably benign
Transcript: ENSMUST00000226142
AA Change: H21Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000226635
AA Change: H58Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000226728
Predicted Effect probably benign
Transcript: ENSMUST00000226829
AA Change: H58Q

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Other mutations in Vmn1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Vmn1r36 APN 6 66716462 missense probably damaging 0.98
R0610:Vmn1r36 UTSW 6 66716420 missense probably damaging 0.99
R0864:Vmn1r36 UTSW 6 66716856 missense probably null
R1754:Vmn1r36 UTSW 6 66716533 frame shift probably null
R1813:Vmn1r36 UTSW 6 66716772 missense probably benign
R1844:Vmn1r36 UTSW 6 66716763 missense probably benign 0.00
R1896:Vmn1r36 UTSW 6 66716772 missense probably benign
R4852:Vmn1r36 UTSW 6 66716888 start codon destroyed probably null 1.00
R4899:Vmn1r36 UTSW 6 66716565 missense possibly damaging 0.93
R5985:Vmn1r36 UTSW 6 66716871 missense probably benign 0.02
R6235:Vmn1r36 UTSW 6 66716246 missense probably benign 0.00
R7313:Vmn1r36 UTSW 6 66716123 missense probably benign
R7511:Vmn1r36 UTSW 6 66716930 start gained probably benign
R8046:Vmn1r36 UTSW 6 66715980 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGAATGACAAATTGAGAGACC -3'
(R):5'- GAAGTATGCTTCCTCTATGTGCTTAAG -3'

Sequencing Primer
(F):5'- ATGCAGATAGAGAGGCCT -3'
(R):5'- CCTCTATGTGCTTAAGATGAATACAC -3'
Posted On2015-01-11