Incidental Mutation 'R2987:Exoc6b'
ID257820
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84851947 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Isoleucine at position 485 (K485I)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197] [ENSMUST00000162821]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000051531
Predicted Effect probably damaging
Transcript: ENSMUST00000160197
AA Change: K485I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: K485I

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162821
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2122:Exoc6b UTSW 6 84621482 missense probably benign 0.01
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
R7574:Exoc6b UTSW 6 84791384 critical splice acceptor site probably null
R7607:Exoc6b UTSW 6 84989409 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTGAAAGCCTATTCCAAAGTTCC -3'
(R):5'- CAATACTTTACAGGGTAGGACAAAG -3'

Sequencing Primer
(F):5'- GTTCCAAACTCATAGCAAAGACTTTC -3'
(R):5'- AGAGAGGCCCTTTAGACTTGC -3'
Posted On2015-01-11