Mutagenetix > Incidental Mutation

Incidental Mutation 'R2987:Usp17lc'

257821

Institutional Source

Beutler Lab

Gene Symbol

Usp17lc

Ensembl Gene

ENSMUSG00000058976

Gene Name

ubiquitin specific peptidase 17-like C

Synonyms

Dub2, Usp17l5, Dub2b, Dub-2

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103415072-103419880 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103418302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 268 (V268A)

Ref Sequence

ENSEMBL: ENSMUSP00000102505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079348] [ENSMUST00000106892]

AlphaFold

G5E8I7

Predicted Effect

probably damaging
Transcript: ENSMUST00000079348
AA Change: V268A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078323
Gene: ENSMUSG00000058976
AA Change: V268A

Domain	Start	End	E-Value	Type
Pfam:UCH	50	345	3.8e-54	PFAM
Pfam:UCH_1	51	327	3.5e-25	PFAM
low complexity region	374	385	N/A	INTRINSIC
low complexity region	529	539	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106892
AA Change: V268A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000102505
Gene: ENSMUSG00000058976
AA Change: V268A

Domain	Start	End	E-Value	Type
Pfam:UCH	50	345	1.3e-60	PFAM
Pfam:UCH_1	51	327	5.5e-30	PFAM
low complexity region	374	385	N/A	INTRINSIC
low complexity region	529	539	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116717

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 94.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic elthality before implantation, failure to hatch from the zona pellucida, decreased cell proliferation and increased apoptosis. Mice heterozygous for this allele exhibit abnormal body, testis and thymus weight and reduced sperm motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	T	C	5: 30,197,360	I557V	probably damaging	Het
Bag6	T	A	17: 35,145,685	L983*	probably null	Het
Clcn1	A	G	6: 42,298,850	Y302C	probably damaging	Het
Dlc1	A	T	8: 36,574,152	C1308S	probably damaging	Het
Ebna1bp2	A	G	4: 118,620,936	D2G	probably damaging	Het
Exoc6b	T	A	6: 84,851,947	K485I	probably damaging	Het
Galnt3	C	T	2: 66,084,241	E611K	probably benign	Het
Gm5901	A	G	7: 105,377,300	I92V	probably benign	Het
Kcnh8	A	T	17: 52,956,735	L753F	probably benign	Het
L3mbtl4	T	C	17: 68,359,518	S14P	possibly damaging	Het
Map4k4	A	G	1: 39,986,765	H305R	probably damaging	Het
Nid1	A	T	13: 13,499,673	Y879F	probably benign	Het
Nsf	A	T	11: 103,859,043		probably null	Het
Olfml2a	G	A	2: 38,947,294	V150M	probably damaging	Het
Olfr645	A	G	7: 104,084,870	V70A	probably benign	Het
Pkhd1	A	T	1: 20,104,599	D3744E	possibly damaging	Het
Pla1a	A	T	16: 38,407,742	C258S	probably damaging	Het
Plk2	A	T	13: 110,397,709	R274S	probably benign	Het
Sumf2	T	C	5: 129,847,084	L30P	possibly damaging	Het
Synpo2	T	C	3: 123,116,973	H341R	probably damaging	Het
Trbv12-1	G	A	6: 41,113,906	E71K	probably benign	Het
Vmn1r36	A	T	6: 66,716,716	H21Q	probably benign	Het

Other mutations in Usp17lc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Usp17lc	APN	7	103418941	missense	possibly damaging	0.74
IGL00499:Usp17lc	APN	7	103418466	missense	probably damaging	1.00
IGL00499:Usp17lc	APN	7	103418465	missense	probably damaging	1.00
IGL01446:Usp17lc	APN	7	103418444	missense	probably benign	0.00
R1466:Usp17lc	UTSW	7	103418941	missense	possibly damaging	0.74
R1466:Usp17lc	UTSW	7	103418941	missense	possibly damaging	0.74
R1584:Usp17lc	UTSW	7	103418941	missense	possibly damaging	0.74
R1754:Usp17lc	UTSW	7	103418848	missense	probably benign	0.01
R3969:Usp17lc	UTSW	7	103418419	missense	probably damaging	1.00
R4661:Usp17lc	UTSW	7	103418590	missense	probably benign	0.00
R5118:Usp17lc	UTSW	7	103418661	missense	probably benign	0.05
R5413:Usp17lc	UTSW	7	103418556	missense	probably benign
R6962:Usp17lc	UTSW	7	103418911	missense	probably benign	0.00
R7412:Usp17lc	UTSW	7	103418368	missense	probably damaging	1.00
R7638:Usp17lc	UTSW	7	103418499	missense	probably damaging	1.00
R7748:Usp17lc	UTSW	7	103418481	missense	probably damaging	1.00
R8194:Usp17lc	UTSW	7	103418200	missense	probably benign	0.00
R8303:Usp17lc	UTSW	7	103418182	missense	possibly damaging	0.88
R8815:Usp17lc	UTSW	7	103418317	missense	probably benign	0.01
R8859:Usp17lc	UTSW	7	103415109	missense	probably benign	0.01
R9023:Usp17lc	UTSW	7	103418332	missense	possibly damaging	0.88
R9200:Usp17lc	UTSW	7	103418898	missense	probably benign	0.14
R9658:Usp17lc	UTSW	7	103418182	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- TGGATATCAGCTCAGCTCAGAGTG -3'
(R):5'- ATCGCAGCTGGTGACCTTAG -3'

Sequencing Primer
(F):5'- CTCAGAGTGTAAATCAAGCCTTGTGG -3'
(R):5'- GCAGCTGGTGACCTTAGTATCATC -3'

Posted On

2015-01-11