Incidental Mutation 'R2987:Olfr645'
ID257822
Institutional Source Beutler Lab
Gene Symbol Olfr645
Ensembl Gene ENSMUSG00000051340
Gene Nameolfactory receptor 645
SynonymsGA_x6K02T2PBJ9-6819097-6818150, MOR13-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104081789-104085465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104084870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 70 (V70A)
Ref Sequence ENSEMBL: ENSMUSP00000062821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057104] [ENSMUST00000138055]
Predicted Effect probably benign
Transcript: ENSMUST00000057104
AA Change: V70A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062821
Gene: ENSMUSG00000051340
AA Change: V70A

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 5.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 256 8e-8 PFAM
Pfam:7tm_1 43 295 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Olfr645
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1303:Olfr645 UTSW 7 104084741 missense probably damaging 1.00
R1488:Olfr645 UTSW 7 104084652 missense probably benign
R1556:Olfr645 UTSW 7 104084261 missense probably benign
R2158:Olfr645 UTSW 7 104084826 missense probably benign
R4437:Olfr645 UTSW 7 104084921 missense possibly damaging 0.88
R4773:Olfr645 UTSW 7 104084295 missense probably damaging 1.00
R5285:Olfr645 UTSW 7 104084133 makesense probably null
R5396:Olfr645 UTSW 7 104084891 missense probably benign 0.08
R5516:Olfr645 UTSW 7 104084237 missense possibly damaging 0.53
R5761:Olfr645 UTSW 7 104084169 missense probably benign 0.01
R5793:Olfr645 UTSW 7 104085030 missense probably benign 0.10
R5960:Olfr645 UTSW 7 104084353 missense probably damaging 1.00
R6242:Olfr645 UTSW 7 104084564 missense possibly damaging 0.82
R6676:Olfr645 UTSW 7 104084454 missense probably benign 0.02
R6975:Olfr645 UTSW 7 104084795 missense probably benign
R8202:Olfr645 UTSW 7 104084991 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGCGCAGTGGATTGCATATAGC -3'
(R):5'- ATGGGGAACTTCAGGATCAATG -3'

Sequencing Primer
(F):5'- GCTACATAGTGATCAAAGCTCATGGC -3'
(R):5'- TCAGGATCAATGCCTCTCAGG -3'
Posted On2015-01-11