Incidental Mutation 'R2987:Plk2'
List |< first << previous [record 18 of 23] next >> last >|
ID257826
Institutional Source Beutler Lab
Gene Symbol Plk2
Ensembl Gene ENSMUSG00000021701
Gene Namepolo like kinase 2
SynonymsSnk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location110395046-110400844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110397709 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 274 (R274S)
Ref Sequence ENSEMBL: ENSMUSP00000022212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022212]
Predicted Effect probably benign
Transcript: ENSMUST00000022212
AA Change: R274S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022212
Gene: ENSMUSG00000021701
AA Change: R274S

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
S_TKc 79 331 7.08e-97 SMART
Blast:STYKc 335 383 9e-7 BLAST
low complexity region 448 464 N/A INTRINSIC
Pfam:POLO_box 508 569 2.5e-19 PFAM
Pfam:POLO_box 604 673 1.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225340
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the polo family of serine/threonine protein kinases that have a role in normal cell division. This gene is most abundantly expressed in testis, spleen and fetal tissues, and its expression is inducible by serum, suggesting that it may also play an important role in cells undergoing rapid cell division. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Inactivation of this gene results in impaired embryonic growth and placental defects due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Pla1a A T 16: 38,407,742 C258S probably damaging Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Plk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Plk2 APN 13 110398764 missense probably benign 0.18
IGL00586:Plk2 APN 13 110396378 missense possibly damaging 0.61
IGL00798:Plk2 APN 13 110398034 missense probably benign 0.00
IGL01450:Plk2 APN 13 110396324 missense probably damaging 1.00
IGL01722:Plk2 APN 13 110399442 missense probably benign 0.00
IGL01937:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01945:Plk2 APN 13 110399054 missense possibly damaging 0.80
IGL01993:Plk2 APN 13 110399197 missense probably damaging 1.00
IGL02231:Plk2 APN 13 110400069 missense probably benign 0.01
IGL03059:Plk2 APN 13 110399134 missense probably benign 0.42
Mite UTSW 13 110396036 nonsense probably null
R0189:Plk2 UTSW 13 110399463 missense probably damaging 1.00
R0324:Plk2 UTSW 13 110397708 missense probably benign 0.08
R1108:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1422:Plk2 UTSW 13 110399489 missense probably damaging 0.99
R1513:Plk2 UTSW 13 110400088 missense probably benign 0.45
R4050:Plk2 UTSW 13 110399866 missense probably damaging 1.00
R4211:Plk2 UTSW 13 110396337 missense probably damaging 0.98
R4278:Plk2 UTSW 13 110396103 missense probably benign 0.15
R4777:Plk2 UTSW 13 110397773 missense probably benign
R5121:Plk2 UTSW 13 110399424 missense probably benign 0.01
R5677:Plk2 UTSW 13 110399057 missense possibly damaging 0.83
R6240:Plk2 UTSW 13 110399474 missense probably damaging 1.00
R6240:Plk2 UTSW 13 110400034 missense probably damaging 1.00
R6436:Plk2 UTSW 13 110396036 nonsense probably null
R6596:Plk2 UTSW 13 110397762 missense probably benign 0.37
R6776:Plk2 UTSW 13 110399791 missense probably benign
R6938:Plk2 UTSW 13 110396680 nonsense probably null
R7556:Plk2 UTSW 13 110396588 splice site probably null
Z1177:Plk2 UTSW 13 110395259 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCAGACATCTGGGCCTTAGG -3'
(R):5'- GTGAAACCCTGTGGAACCAG -3'

Sequencing Primer
(F):5'- GGCTGTGTAATGTAAGTAAATGCAC -3'
(R):5'- GGTCAAAGAGCACTGACCTGC -3'
Posted On2015-01-11