Incidental Mutation 'R2987:Pla1a'
List [record 1 of 23] next >> last >|
ID257828
Institutional Source Beutler Lab
Gene Symbol Pla1a
Ensembl Gene ENSMUSG00000002847
Gene Namephospholipase A1 member A
SynonymsPs-pla1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2987 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location38396117-38433145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38407742 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 258 (C258S)
Ref Sequence ENSEMBL: ENSMUSP00000002926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002926]
Predicted Effect probably damaging
Transcript: ENSMUST00000002926
AA Change: C258S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002926
Gene: ENSMUSG00000002847
AA Change: C258S

DomainStartEndE-ValueType
Pfam:Lipase 15 336 9.4e-111 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,197,360 I557V probably damaging Het
Bag6 T A 17: 35,145,685 L983* probably null Het
Clcn1 A G 6: 42,298,850 Y302C probably damaging Het
Dlc1 A T 8: 36,574,152 C1308S probably damaging Het
Ebna1bp2 A G 4: 118,620,936 D2G probably damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Galnt3 C T 2: 66,084,241 E611K probably benign Het
Gm5901 A G 7: 105,377,300 I92V probably benign Het
Kcnh8 A T 17: 52,956,735 L753F probably benign Het
L3mbtl4 T C 17: 68,359,518 S14P possibly damaging Het
Map4k4 A G 1: 39,986,765 H305R probably damaging Het
Nid1 A T 13: 13,499,673 Y879F probably benign Het
Nsf A T 11: 103,859,043 probably null Het
Olfml2a G A 2: 38,947,294 V150M probably damaging Het
Olfr645 A G 7: 104,084,870 V70A probably benign Het
Pkhd1 A T 1: 20,104,599 D3744E possibly damaging Het
Plk2 A T 13: 110,397,709 R274S probably benign Het
Sumf2 T C 5: 129,847,084 L30P possibly damaging Het
Synpo2 T C 3: 123,116,973 H341R probably damaging Het
Trbv12-1 G A 6: 41,113,906 E71K probably benign Het
Usp17lc T C 7: 103,418,302 V268A probably damaging Het
Vmn1r36 A T 6: 66,716,716 H21Q probably benign Het
Other mutations in Pla1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pla1a APN 16 38414850 missense probably damaging 1.00
IGL01086:Pla1a APN 16 38407622 missense probably benign 0.02
IGL01126:Pla1a APN 16 38407639 missense probably benign
R1674:Pla1a UTSW 16 38414810 missense probably benign 0.00
R2101:Pla1a UTSW 16 38415368 missense probably damaging 0.99
R2415:Pla1a UTSW 16 38407750 missense possibly damaging 0.69
R4492:Pla1a UTSW 16 38409610 missense probably benign
R5365:Pla1a UTSW 16 38417207 missense probably benign 0.01
R5424:Pla1a UTSW 16 38414775 missense probably damaging 1.00
R6349:Pla1a UTSW 16 38417124 missense probably benign 0.04
R6388:Pla1a UTSW 16 38397472 missense probably benign
R6443:Pla1a UTSW 16 38409587 splice site probably null
R6996:Pla1a UTSW 16 38397468 missense probably benign 0.04
R7021:Pla1a UTSW 16 38400882 missense probably damaging 0.97
R7519:Pla1a UTSW 16 38414846 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCCAAATTGCCAAGGTTAGC -3'
(R):5'- GAGGTAGGCAGGTCTGTTAATAC -3'

Sequencing Primer
(F):5'- CGAGGTTAGCCAAGGTTAGCC -3'
(R):5'- TAATACTTCAAAGTGTCGCCCAGGG -3'
Posted On2015-01-11