Incidental Mutation 'R2988:Actn1'
ID257845
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R2988 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80192388 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 248 (A248S)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021554
AA Change: A248S

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: A248S

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167327
AA Change: A248S

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: A248S

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220351
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chd9 A G 8: 91,030,460 probably null Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
Kcnh7 T A 2: 62,721,828 I940F probably benign Het
Lipk T C 19: 34,021,737 F139S probably damaging Het
Nr1h3 T C 2: 91,185,004 N285S probably damaging Het
Olfr398 C A 11: 73,983,801 R269L probably benign Het
Olfr484 G A 7: 108,124,838 Q142* probably null Het
Ptpro C T 6: 137,443,599 Q188* probably null Het
Slc22a8 A G 19: 8,610,248 T529A probably benign Het
Spef2 A T 15: 9,682,623 S591T probably benign Het
Tmem161b C T 13: 84,292,455 R149* probably null Het
Trp53 T C 11: 69,588,506 V170A probably damaging Het
Ttc37 T A 13: 76,155,689 M1242K probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6499:Actn1 UTSW 12 80168417 missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80199008 missense probably damaging 1.00
R8171:Actn1 UTSW 12 80196393 critical splice donor site probably null
R8287:Actn1 UTSW 12 80174078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGGCAAACAAGACCTCTTC -3'
(R):5'- TGGAAGTTGACTCTGAAAGCTG -3'

Sequencing Primer
(F):5'- GAGGCAAACAAGACCTCTTCAGAAAC -3'
(R):5'- GACTCTGAAAGCTGGCTAGATTC -3'
Posted On2015-01-11