Incidental Mutation 'R0326:Ntng1'
ID25785
Institutional Source Beutler Lab
Gene Symbol Ntng1
Ensembl Gene ENSMUSG00000059857
Gene Namenetrin G1
SynonymsLmnt1, A930010C08Rik
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location109780040-110144011 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 110135503 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 2 (Y2*)
Ref Sequence ENSEMBL: ENSMUSP00000119534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072596] [ENSMUST00000106570] [ENSMUST00000106571] [ENSMUST00000106575] [ENSMUST00000128219] [ENSMUST00000131027] [ENSMUST00000133268] [ENSMUST00000138344] [ENSMUST00000138953] [ENSMUST00000156177]
Predicted Effect probably null
Transcript: ENSMUST00000072596
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000072397
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106570
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000102180
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 1.28e-3 SMART
EGF 388 420 5.12e-3 SMART
low complexity region 444 459 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106571
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000102181
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 408 440 5.12e-3 SMART
low complexity region 464 479 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106575
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000102185
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 355 3.33e-2 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF_Lam 420 462 5.74e-6 SMART
EGF 466 498 5.12e-3 SMART
low complexity region 522 537 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128219
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000116579
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LamNT 59 295 1.5e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131027
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000118800
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 417 4.81e-8 SMART
EGF 421 453 5.12e-3 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133268
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000117371
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 365 397 5.12e-3 SMART
low complexity region 421 436 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138344
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000120688
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF_Lam 364 406 5.74e-6 SMART
EGF 410 442 5.12e-3 SMART
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138953
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000116213
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 407 439 5.12e-3 SMART
low complexity region 463 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156177
AA Change: Y2*
SMART Domains Protein: ENSMUSP00000119534
Gene: ENSMUSG00000059857
AA Change: Y2*

DomainStartEndE-ValueType
LamNT 59 295 3.22e-18 SMART
EGF_Lam 297 354 6.86e-4 SMART
EGF 387 419 5.12e-3 SMART
low complexity region 443 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189335
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is processed into a secreted protein containing eukaroytic growth factor (EGF)-like domains. This protein acts to guide axon growth during neuronal development. Polymorphisms in this gene may be associated with schizophrenia. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele survive into adulthood with no major alterations in gross brain cytoarchitecture or axonal projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Ntng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Ntng1 APN 3 109934995 nonsense probably null
IGL02367:Ntng1 APN 3 110135513 splice site probably null
IGL02448:Ntng1 APN 3 109934559 splice site probably benign
IGL02487:Ntng1 APN 3 109935047 missense probably damaging 0.98
IGL02500:Ntng1 APN 3 110135330 missense probably damaging 1.00
IGL02578:Ntng1 APN 3 110135394 missense probably benign 0.01
IGL03009:Ntng1 APN 3 109934702 missense possibly damaging 0.89
IGL03096:Ntng1 APN 3 110135349 missense probably benign 0.19
R0108:Ntng1 UTSW 3 109851755 splice site probably benign
R0403:Ntng1 UTSW 3 109934611 missense probably damaging 0.97
R0699:Ntng1 UTSW 3 109872295 missense probably damaging 1.00
R0702:Ntng1 UTSW 3 109872254 missense probably damaging 1.00
R1981:Ntng1 UTSW 3 109935010 missense possibly damaging 0.61
R2096:Ntng1 UTSW 3 109832555 missense probably damaging 0.99
R3739:Ntng1 UTSW 3 109934691 missense probably damaging 1.00
R3963:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4484:Ntng1 UTSW 3 110143808 unclassified probably benign
R4516:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4518:Ntng1 UTSW 3 109935013 missense probably damaging 1.00
R4520:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4523:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4524:Ntng1 UTSW 3 109934996 missense probably damaging 1.00
R4776:Ntng1 UTSW 3 109934713 missense probably damaging 1.00
R4817:Ntng1 UTSW 3 109934868 missense probably damaging 1.00
R4827:Ntng1 UTSW 3 110135411 missense probably damaging 1.00
R4990:Ntng1 UTSW 3 110135261 critical splice donor site probably null
R5067:Ntng1 UTSW 3 110135345 missense possibly damaging 0.95
R5087:Ntng1 UTSW 3 110135329 nonsense probably null
R5196:Ntng1 UTSW 3 109934983 missense probably damaging 1.00
R5263:Ntng1 UTSW 3 109934872 missense probably damaging 0.99
R5743:Ntng1 UTSW 3 110135420 missense probably damaging 1.00
R6268:Ntng1 UTSW 3 109935035 missense probably damaging 1.00
R6292:Ntng1 UTSW 3 110143886 unclassified probably benign
R6419:Ntng1 UTSW 3 109782853 missense possibly damaging 0.95
R6898:Ntng1 UTSW 3 109872218 missense probably damaging 0.98
R7081:Ntng1 UTSW 3 109851789 missense probably benign 0.00
R7090:Ntng1 UTSW 3 109935180 nonsense probably null
R7134:Ntng1 UTSW 3 109935129 missense probably benign
R7302:Ntng1 UTSW 3 109832617 missense possibly damaging 0.94
R7353:Ntng1 UTSW 3 110135447 missense probably damaging 1.00
R7408:Ntng1 UTSW 3 109853082 missense probably benign 0.00
R7610:Ntng1 UTSW 3 109934825 missense probably damaging 1.00
R7686:Ntng1 UTSW 3 109935014 missense possibly damaging 0.80
R7972:Ntng1 UTSW 3 110135486 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTCACCATTGCACAGAAGGAC -3'
(R):5'- TCCTCAGCATACCTGACCGCATAG -3'

Sequencing Primer
(F):5'- AGGGTCTCCACAGGTAATATCCG -3'
(R):5'- GCATACCTGACCGCATAGAATATTTC -3'
Posted On2013-04-16