Incidental Mutation 'R2989:Olfr918'
ID257866
Institutional Source Beutler Lab
Gene Symbol Olfr918
Ensembl Gene ENSMUSG00000046150
Gene Nameolfactory receptor 918
SynonymsGA_x6K02T2PVTD-32375756-32374818, MOR164-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R2989 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38669861-38674601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38672535 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 303 (M303K)
Ref Sequence ENSEMBL: ENSMUSP00000150182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055099] [ENSMUST00000215461]
Predicted Effect probably benign
Transcript: ENSMUST00000055099
AA Change: M316K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057210
Gene: ENSMUSG00000046150
AA Change: M316K

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:7tm_4 44 319 6.5e-48 PFAM
Pfam:7tm_1 54 301 3.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213750
Predicted Effect probably benign
Transcript: ENSMUST00000215461
AA Change: M303K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216579
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,581,747 T205I probably damaging Het
Arhgap32 T A 9: 32,239,398 N31K possibly damaging Het
C1galt1 A G 6: 7,866,622 D156G possibly damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Coil C A 11: 88,987,979 A520D probably damaging Het
Cpe G T 8: 64,597,515 N386K probably benign Het
Fat4 T C 3: 39,007,153 I4295T probably benign Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,577,216 probably null Het
Intu A G 3: 40,692,710 K671R probably benign Het
Jup T C 11: 100,376,841 D552G possibly damaging Het
Kcnk9 T C 15: 72,512,358 T324A unknown Het
Mettl5 G T 2: 69,881,315 A69E probably damaging Het
Rpf2 A G 10: 40,239,753 S77P probably benign Het
Sgo1 A G 17: 53,687,134 Y97H probably benign Het
Srsf12 T C 4: 33,223,599 Y33H probably damaging Het
Tcerg1 T A 18: 42,519,475 M56K unknown Het
Trafd1 T C 5: 121,379,466 T63A probably damaging Het
Ttc28 G A 5: 111,224,015 V777I probably benign Het
Ubr4 A G 4: 139,463,558 E937G possibly damaging Het
Zfp677 T C 17: 21,396,852 I57T probably benign Het
Zfp981 T A 4: 146,537,890 I424N probably benign Het
Other mutations in Olfr918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr918 APN 9 38673024 missense probably benign 0.01
IGL01388:Olfr918 APN 9 38673083 nonsense probably null
IGL01516:Olfr918 APN 9 38672863 missense probably benign 0.09
IGL02121:Olfr918 APN 9 38673415 missense probably damaging 0.98
IGL02209:Olfr918 APN 9 38673046 missense possibly damaging 0.84
IGL02256:Olfr918 APN 9 38673480 start codon destroyed probably null
IGL02517:Olfr918 APN 9 38672913 missense probably damaging 1.00
IGL02648:Olfr918 APN 9 38673016 missense probably benign
IGL02747:Olfr918 APN 9 38673084 missense probably benign 0.11
IGL02971:Olfr918 APN 9 38673268 missense probably damaging 0.96
E0370:Olfr918 UTSW 9 38672561 missense probably damaging 0.99
R0616:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R2173:Olfr918 UTSW 9 38672944 missense probably benign 0.03
R3430:Olfr918 UTSW 9 38673139 missense probably damaging 1.00
R3809:Olfr918 UTSW 9 38672863 missense probably benign 0.09
R4688:Olfr918 UTSW 9 38673363 missense probably damaging 1.00
R4702:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R5548:Olfr918 UTSW 9 38673304 missense probably benign 0.00
R5590:Olfr918 UTSW 9 38672965 missense probably damaging 1.00
R6082:Olfr918 UTSW 9 38672570 missense probably damaging 1.00
R6214:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6215:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6893:Olfr918 UTSW 9 38673059 missense possibly damaging 0.95
R7215:Olfr918 UTSW 9 38673447 missense probably benign 0.05
R7624:Olfr918 UTSW 9 38672623 missense probably benign 0.18
R7862:Olfr918 UTSW 9 38673328 missense probably benign 0.01
R8116:Olfr918 UTSW 9 38673168 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACAGCCCTTGTGTTACACAC -3'
(R):5'- CCTGCAGCTCTCACATTATGG -3'

Sequencing Primer
(F):5'- CACACCATTGTTATAACACAAGTTTG -3'
(R):5'- GCAGCTCTCACATTATGGCAATTTC -3'
Posted On2015-01-11