Incidental Mutation 'R2989:Foxn1'
ID257870
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2989 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 78358777 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 641 (G641R)
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108294
AA Change: G641R

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057
AA Change: G641R

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,581,747 T205I probably damaging Het
Arhgap32 T A 9: 32,239,398 N31K possibly damaging Het
C1galt1 A G 6: 7,866,622 D156G possibly damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Coil C A 11: 88,987,979 A520D probably damaging Het
Cpe G T 8: 64,597,515 N386K probably benign Het
Fat4 T C 3: 39,007,153 I4295T probably benign Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,577,216 probably null Het
Intu A G 3: 40,692,710 K671R probably benign Het
Jup T C 11: 100,376,841 D552G possibly damaging Het
Kcnk9 T C 15: 72,512,358 T324A unknown Het
Mettl5 G T 2: 69,881,315 A69E probably damaging Het
Olfr918 A T 9: 38,672,535 M303K probably benign Het
Rpf2 A G 10: 40,239,753 S77P probably benign Het
Sgo1 A G 17: 53,687,134 Y97H probably benign Het
Srsf12 T C 4: 33,223,599 Y33H probably damaging Het
Tcerg1 T A 18: 42,519,475 M56K unknown Het
Trafd1 T C 5: 121,379,466 T63A probably damaging Het
Ttc28 G A 5: 111,224,015 V777I probably benign Het
Ubr4 A G 4: 139,463,558 E937G possibly damaging Het
Zfp677 T C 17: 21,396,852 I57T probably benign Het
Zfp981 T A 4: 146,537,890 I424N probably benign Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1905:Foxn1 UTSW 11 78371810 splice site probably null
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
R7176:Foxn1 UTSW 11 78360867 missense possibly damaging 0.94
R7331:Foxn1 UTSW 11 78358789 missense probably damaging 1.00
R7515:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R7562:Foxn1 UTSW 11 78371132 missense probably damaging 1.00
R7657:Foxn1 UTSW 11 78365964 missense probably benign 0.29
R8838:Foxn1 UTSW 11 78361612 missense possibly damaging 0.52
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCAGGTAGCATCCTAGATG -3'
(R):5'- CGACGTCATCCTCCATGTTG -3'

Sequencing Primer
(F):5'- AGATGGATGCCCCCAACTTCTG -3'
(R):5'- TGTTGCCACCCCCACCAG -3'
Posted On2015-01-11