Incidental Mutation 'R2990:Itfg1'
ID257886
Institutional Source Beutler Lab
Gene Symbol Itfg1
Ensembl Gene ENSMUSG00000031703
Gene Nameintegrin alpha FG-GAP repeat containing 1
SynonymsD8Wsu49e, 2310047C21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2990 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85717578-85840921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85835049 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000034140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034140]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034140
AA Change: T152A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034140
Gene: ENSMUSG00000031703
AA Change: T152A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SCOP:d1m1xa4 46 232 5e-3 SMART
low complexity region 482 496 N/A INTRINSIC
transmembrane domain 564 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Eipr1 C T 12: 28,859,268 T178I probably benign Het
Fzd1 A G 5: 4,755,758 V608A probably damaging Het
Gimap3 G T 6: 48,765,851 F48L probably damaging Het
Katnbl1 G T 2: 112,404,240 K22N probably damaging Het
Lipm A G 19: 34,116,486 I268V probably benign Het
Mapk8ip3 T C 17: 24,905,292 I516V probably benign Het
Myo9a T C 9: 59,924,889 L2567P possibly damaging Het
Npy A G 6: 49,827,512 E71G possibly damaging Het
Parp2 A G 14: 50,817,000 T203A probably benign Het
Rprd1a A C 18: 24,506,839 L262V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Stat5b T C 11: 100,808,362 probably null Het
Syde2 T C 3: 146,001,497 F664S probably damaging Het
Tenm4 G T 7: 96,893,125 probably null Het
Wapl A G 14: 34,736,708 N909S probably damaging Het
Other mutations in Itfg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Itfg1 APN 8 85780565 missense possibly damaging 0.95
IGL02803:Itfg1 APN 8 85725511 splice site probably null
R0368:Itfg1 UTSW 8 85764407 missense probably damaging 1.00
R0755:Itfg1 UTSW 8 85726205 missense possibly damaging 0.90
R1183:Itfg1 UTSW 8 85780523 missense probably benign 0.04
R1529:Itfg1 UTSW 8 85810614 missense probably benign 0.02
R1789:Itfg1 UTSW 8 85725512 critical splice donor site probably null
R1953:Itfg1 UTSW 8 85831231 missense probably benign 0.31
R2206:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2207:Itfg1 UTSW 8 85776198 missense probably benign 0.17
R2260:Itfg1 UTSW 8 85722677 missense probably damaging 1.00
R2358:Itfg1 UTSW 8 85738129 missense probably damaging 1.00
R2876:Itfg1 UTSW 8 85780510 splice site probably benign
R4484:Itfg1 UTSW 8 85726249 missense probably damaging 1.00
R4762:Itfg1 UTSW 8 85732441 missense possibly damaging 0.95
R5146:Itfg1 UTSW 8 85718868 makesense probably null
R5796:Itfg1 UTSW 8 85718893 missense probably damaging 1.00
R5805:Itfg1 UTSW 8 85766972 missense probably benign 0.04
R6084:Itfg1 UTSW 8 85726170 missense probably benign 0.01
R6187:Itfg1 UTSW 8 85836465 missense probably damaging 1.00
R6319:Itfg1 UTSW 8 85840629 missense probably damaging 1.00
R6463:Itfg1 UTSW 8 85736151 missense probably benign 0.03
R6490:Itfg1 UTSW 8 85740301 missense probably benign 0.08
R6492:Itfg1 UTSW 8 85740349 missense probably benign 0.14
R6588:Itfg1 UTSW 8 85736130 missense probably benign
R6753:Itfg1 UTSW 8 85835078 missense probably benign 0.04
R7489:Itfg1 UTSW 8 85767001 missense probably damaging 1.00
R7665:Itfg1 UTSW 8 85764350 missense probably benign
R7912:Itfg1 UTSW 8 85764280 missense probably damaging 1.00
R7985:Itfg1 UTSW 8 85725568 missense probably damaging 1.00
X0067:Itfg1 UTSW 8 85840753 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACTATGTAATCCTGCATATAGGTTCC -3'
(R):5'- TCTCCTTAGTGATAGCTATTGCAG -3'

Sequencing Primer
(F):5'- TACTGGGGCATCAAGTCTTCACAG -3'
(R):5'- TGCAGGAAATTAGAGATGAATCTTG -3'
Posted On2015-01-11