Incidental Mutation 'R0326:Ptch2'
Institutional Source Beutler Lab
Gene Symbol Ptch2
Ensembl Gene ENSMUSG00000028681
Gene Namepatched 2
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosomal Location117096075-117116101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117108884 bp
Amino Acid Change Glycine to Aspartic acid at position 467 (G467D)
Ref Sequence ENSEMBL: ENSMUSP00000030443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]
Predicted Effect probably damaging
Transcript: ENSMUST00000030443
AA Change: G467D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681
AA Change: G467D

low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Pfam:Patched 338 831 1.6e-42 PFAM
Pfam:Sterol-sensing 418 570 9.5e-49 PFAM
Pfam:Patched 901 1116 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135133
Predicted Effect probably benign
Transcript: ENSMUST00000137209
SMART Domains Protein: ENSMUSP00000114461
Gene: ENSMUSG00000028681

low complexity region 75 86 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144620
SMART Domains Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156989
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Ptch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ptch2 APN 4 117114082 missense probably damaging 1.00
IGL01684:Ptch2 APN 4 117104787 missense probably damaging 1.00
IGL01967:Ptch2 APN 4 117114233 splice site probably benign
IGL02449:Ptch2 APN 4 117108183 missense possibly damaging 0.79
IGL02488:Ptch2 APN 4 117110396 missense probably damaging 0.99
IGL02935:Ptch2 APN 4 117114770 missense probably damaging 1.00
R0103:Ptch2 UTSW 4 117109425 splice site probably benign
R0403:Ptch2 UTSW 4 117110839 nonsense probably null
R0499:Ptch2 UTSW 4 117111143 nonsense probably null
R0550:Ptch2 UTSW 4 117096433 splice site probably benign
R0565:Ptch2 UTSW 4 117106143 splice site probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1484:Ptch2 UTSW 4 117110849 missense probably damaging 0.97
R1920:Ptch2 UTSW 4 117108661 missense probably benign 0.09
R4080:Ptch2 UTSW 4 117111206 missense probably damaging 1.00
R4611:Ptch2 UTSW 4 117110378 missense probably benign 0.24
R5117:Ptch2 UTSW 4 117105949 missense probably damaging 1.00
R5240:Ptch2 UTSW 4 117106138 splice site probably benign
R5936:Ptch2 UTSW 4 117108294 missense probably benign 0.39
R5987:Ptch2 UTSW 4 117110057 missense probably benign 0.13
R6155:Ptch2 UTSW 4 117096908 missense probably damaging 1.00
R7158:Ptch2 UTSW 4 117114784 missense possibly damaging 0.76
R7196:Ptch2 UTSW 4 117114749 missense probably benign 0.23
R7346:Ptch2 UTSW 4 117114652 missense probably benign 0.40
R7380:Ptch2 UTSW 4 117114646 missense possibly damaging 0.92
R7547:Ptch2 UTSW 4 117109964 missense probably damaging 1.00
R7600:Ptch2 UTSW 4 117096225 start gained probably benign
R7731:Ptch2 UTSW 4 117108295 missense probably benign 0.09
R7836:Ptch2 UTSW 4 117105027 splice site probably null
R7874:Ptch2 UTSW 4 117105964 missense possibly damaging 0.83
R7881:Ptch2 UTSW 4 117110388 missense probably benign
R7942:Ptch2 UTSW 4 117106001 missense probably benign 0.01
R8426:Ptch2 UTSW 4 117108172 missense possibly damaging 0.84
X0019:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0024:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0025:Ptch2 UTSW 4 117096986 missense probably damaging 1.00
X0035:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0038:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0039:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0040:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0052:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0053:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0054:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0061:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggggagaagagaatgctcaac -3'
Posted On2013-04-16