Incidental Mutation 'R2990:Lipm'
ID257896
Institutional Source Beutler Lab
Gene Symbol Lipm
Ensembl Gene ENSMUSG00000056078
Gene Namelipase, family member M
SynonymsLipl3, 4632427C23Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R2990 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34100943-34122687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34116486 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 268 (I268V)
Ref Sequence ENSEMBL: ENSMUSP00000025685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025685]
Predicted Effect probably benign
Transcript: ENSMUST00000025685
AA Change: I268V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025685
Gene: ENSMUSG00000056078
AA Change: I268V

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 49 111 3.3e-26 PFAM
Pfam:Abhydrolase_1 92 393 2.6e-29 PFAM
Pfam:Abhydrolase_5 93 387 2.5e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Eipr1 C T 12: 28,859,268 T178I probably benign Het
Fzd1 A G 5: 4,755,758 V608A probably damaging Het
Gimap3 G T 6: 48,765,851 F48L probably damaging Het
Itfg1 T C 8: 85,835,049 T152A possibly damaging Het
Katnbl1 G T 2: 112,404,240 K22N probably damaging Het
Mapk8ip3 T C 17: 24,905,292 I516V probably benign Het
Myo9a T C 9: 59,924,889 L2567P possibly damaging Het
Npy A G 6: 49,827,512 E71G possibly damaging Het
Parp2 A G 14: 50,817,000 T203A probably benign Het
Rprd1a A C 18: 24,506,839 L262V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Stat5b T C 11: 100,808,362 probably null Het
Syde2 T C 3: 146,001,497 F664S probably damaging Het
Tenm4 G T 7: 96,893,125 probably null Het
Wapl A G 14: 34,736,708 N909S probably damaging Het
Other mutations in Lipm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Lipm APN 19 34121145 missense probably damaging 1.00
IGL01789:Lipm APN 19 34118747 missense probably damaging 1.00
IGL01878:Lipm APN 19 34116511 missense possibly damaging 0.63
IGL01897:Lipm APN 19 34121308 missense probably damaging 1.00
IGL02713:Lipm APN 19 34101170 start codon destroyed probably null 0.77
R0029:Lipm UTSW 19 34116548 splice site probably benign
R0352:Lipm UTSW 19 34112875 splice site probably benign
R0565:Lipm UTSW 19 34116506 missense probably benign 0.00
R0815:Lipm UTSW 19 34118761 missense probably benign 0.13
R1658:Lipm UTSW 19 34116447 missense probably benign
R4758:Lipm UTSW 19 34101170 start codon destroyed possibly damaging 0.59
R5446:Lipm UTSW 19 34117887 missense possibly damaging 0.92
R5468:Lipm UTSW 19 34109554 splice site probably null
R5905:Lipm UTSW 19 34111911 missense probably benign
R6066:Lipm UTSW 19 34112974 missense probably damaging 1.00
R6437:Lipm UTSW 19 34121257 missense probably damaging 1.00
R6722:Lipm UTSW 19 34121265 missense probably benign 0.00
R6927:Lipm UTSW 19 34101163 start gained probably benign
R7007:Lipm UTSW 19 34112097 missense probably damaging 1.00
R7031:Lipm UTSW 19 34116471 missense probably benign
R7081:Lipm UTSW 19 34121323 missense possibly damaging 0.90
R7092:Lipm UTSW 19 34121358 missense possibly damaging 0.75
R7419:Lipm UTSW 19 34116481 missense probably benign 0.09
R7426:Lipm UTSW 19 34116198 missense possibly damaging 0.56
R7772:Lipm UTSW 19 34117891 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCCAGATATGATGATCAAG -3'
(R):5'- GCAGCTTGCCCAACATTTTC -3'

Sequencing Primer
(F):5'- TATGTGATACCCAGGCGCCTC -3'
(R):5'- GCCCAACATTTTCTTACAATTTGG -3'
Posted On2015-01-11