Incidental Mutation 'R2991:Plekhg6'
ID257901
Institutional Source Beutler Lab
Gene Symbol Plekhg6
Ensembl Gene ENSMUSG00000038167
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 6
SynonymsLOC213522
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2991 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125362660-125380793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125370469 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 479 (E479G)
Ref Sequence ENSEMBL: ENSMUSP00000037004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042647]
Predicted Effect probably damaging
Transcript: ENSMUST00000042647
AA Change: E479G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037004
Gene: ENSMUSG00000038167
AA Change: E479G

DomainStartEndE-ValueType
RhoGEF 165 352 1.5e-44 SMART
PH 410 511 8.99e-7 SMART
low complexity region 535 557 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik C T 11: 58,610,690 V156I possibly damaging Het
5430419D17Rik A T 7: 131,246,700 D861V probably damaging Het
Adamts15 T A 9: 30,921,394 T282S probably benign Het
Asic2 C A 11: 81,968,037 V50L probably benign Het
Cdadc1 T C 14: 59,586,072 M324V possibly damaging Het
Col12a1 A T 9: 79,700,265 V427D probably damaging Het
Col3a1 C A 1: 45,335,779 probably benign Het
Esp24 A T 17: 39,040,003 E31D possibly damaging Het
Igkv14-100 T A 6: 68,519,351 L76* probably null Het
Itsn2 T C 12: 4,658,474 V843A probably benign Het
Llgl2 T C 11: 115,851,120 S663P probably benign Het
Lsg1 T C 16: 30,561,729 N630S probably damaging Het
Msh4 A G 3: 153,905,860 V42A probably benign Het
Nkx6-1 T C 5: 101,659,535 Y327C probably damaging Het
Olfr1505 G A 19: 13,919,311 C97Y probably damaging Het
Pde4a T C 9: 21,203,243 S369P probably damaging Het
Pkdrej T C 15: 85,819,936 I600V probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rgmb A T 17: 15,821,090 D78E probably damaging Het
Samd12 C T 15: 53,860,196 E34K probably damaging Het
Slc22a21 T G 11: 53,959,369 E220A probably damaging Het
Smc6 A G 12: 11,289,981 E430G probably damaging Het
Snx15 C A 19: 6,121,485 L186F probably damaging Het
Tiam2 A G 17: 3,518,250 E1557G probably benign Het
Vwa8 A T 14: 78,995,149 T644S probably benign Het
Zcchc4 T A 5: 52,804,438 F247Y probably damaging Het
Zmynd11 A G 13: 9,695,822 V165A probably damaging Het
Other mutations in Plekhg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Plekhg6 APN 6 125372551 missense probably null 0.89
IGL01466:Plekhg6 APN 6 125372624 splice site probably benign
IGL01621:Plekhg6 APN 6 125372099 missense probably damaging 1.00
IGL01679:Plekhg6 APN 6 125374979 missense probably benign 0.45
IGL01696:Plekhg6 APN 6 125378830 missense probably benign 0.00
IGL02600:Plekhg6 APN 6 125370600 nonsense probably null
IGL02604:Plekhg6 APN 6 125377379 splice site probably benign
IGL02668:Plekhg6 APN 6 125372803 splice site probably benign
R0370:Plekhg6 UTSW 6 125370660 missense probably damaging 1.00
R0426:Plekhg6 UTSW 6 125364629 unclassified probably null
R1182:Plekhg6 UTSW 6 125372492 missense probably damaging 0.99
R1401:Plekhg6 UTSW 6 125363109 missense probably damaging 1.00
R1855:Plekhg6 UTSW 6 125375839 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R1888:Plekhg6 UTSW 6 125363343 missense probably damaging 1.00
R2264:Plekhg6 UTSW 6 125377468 missense probably benign 0.00
R3980:Plekhg6 UTSW 6 125373183 missense probably damaging 1.00
R4193:Plekhg6 UTSW 6 125373118 missense probably benign 0.01
R4227:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R4689:Plekhg6 UTSW 6 125373181 missense probably benign 0.43
R5532:Plekhg6 UTSW 6 125372551 missense possibly damaging 0.80
R5573:Plekhg6 UTSW 6 125375792 missense possibly damaging 0.56
R6803:Plekhg6 UTSW 6 125363663 missense probably damaging 0.98
R6885:Plekhg6 UTSW 6 125378730 missense probably benign
R7105:Plekhg6 UTSW 6 125378805 missense probably damaging 0.99
R7599:Plekhg6 UTSW 6 125374660 missense probably damaging 0.99
R7626:Plekhg6 UTSW 6 125363668 missense probably benign 0.08
R8069:Plekhg6 UTSW 6 125363046 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTCTCAGACTCTGGAAGGC -3'
(R):5'- GCTCCTGGTAACCAAACCTC -3'

Sequencing Primer
(F):5'- ACCTGCTGCTGGTCAGATCTG -3'
(R):5'- GACAGAGCCAAGGTCATCCGTC -3'
Posted On2015-01-11