Incidental Mutation 'R2991:Pde4a'
ID257904
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R2991 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21203243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 369 (S369P)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
AA Change: S135P

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177
AA Change: S135P

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039413
AA Change: S369P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: S369P

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115458
AA Change: S312P

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: S312P

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131769
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik C T 11: 58,610,690 V156I possibly damaging Het
5430419D17Rik A T 7: 131,246,700 D861V probably damaging Het
Adamts15 T A 9: 30,921,394 T282S probably benign Het
Asic2 C A 11: 81,968,037 V50L probably benign Het
Cdadc1 T C 14: 59,586,072 M324V possibly damaging Het
Col12a1 A T 9: 79,700,265 V427D probably damaging Het
Col3a1 C A 1: 45,335,779 probably benign Het
Esp24 A T 17: 39,040,003 E31D possibly damaging Het
Igkv14-100 T A 6: 68,519,351 L76* probably null Het
Itsn2 T C 12: 4,658,474 V843A probably benign Het
Llgl2 T C 11: 115,851,120 S663P probably benign Het
Lsg1 T C 16: 30,561,729 N630S probably damaging Het
Msh4 A G 3: 153,905,860 V42A probably benign Het
Nkx6-1 T C 5: 101,659,535 Y327C probably damaging Het
Olfr1505 G A 19: 13,919,311 C97Y probably damaging Het
Pkdrej T C 15: 85,819,936 I600V probably benign Het
Plekhg6 T C 6: 125,370,469 E479G probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rgmb A T 17: 15,821,090 D78E probably damaging Het
Samd12 C T 15: 53,860,196 E34K probably damaging Het
Slc22a21 T G 11: 53,959,369 E220A probably damaging Het
Smc6 A G 12: 11,289,981 E430G probably damaging Het
Snx15 C A 19: 6,121,485 L186F probably damaging Het
Tiam2 A G 17: 3,518,250 E1557G probably benign Het
Vwa8 A T 14: 78,995,149 T644S probably benign Het
Zcchc4 T A 5: 52,804,438 F247Y probably damaging Het
Zmynd11 A G 13: 9,695,822 V165A probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
R8167:Pde4a UTSW 9 21206173 missense possibly damaging 0.95
R8297:Pde4a UTSW 9 21166108 missense possibly damaging 0.94
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
R8448:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATAGTCTGTCTTAAAGTCCATGT -3'
(R):5'- GGATGTGGAATTTCTTCAGTAAGTC -3'

Sequencing Primer
(F):5'- CAACTACATGGTGGCTTGTGACC -3'
(R):5'- TCAGTAAGTCCCGCTCCTGG -3'
Posted On2015-01-11