Incidental Mutation 'R2991:Olfr1505'
ID257926
Institutional Source Beutler Lab
Gene Symbol Olfr1505
Ensembl Gene ENSMUSG00000062314
Gene Nameolfactory receptor 1505
SynonymsMOR211-4P, GA_x6K02T2RE5P-4250267-4251217, MOR211-10_i
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2991 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13913530-13921866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13919311 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 97 (C97Y)
Ref Sequence ENSEMBL: ENSMUSP00000148945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081520] [ENSMUST00000216623] [ENSMUST00000216835]
Predicted Effect probably damaging
Transcript: ENSMUST00000081520
AA Change: C97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080235
Gene: ENSMUSG00000062314
AA Change: C97Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.2e-43 PFAM
Pfam:7tm_1 41 290 2.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216623
AA Change: C97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216835
AA Change: C97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik C T 11: 58,610,690 V156I possibly damaging Het
5430419D17Rik A T 7: 131,246,700 D861V probably damaging Het
Adamts15 T A 9: 30,921,394 T282S probably benign Het
Asic2 C A 11: 81,968,037 V50L probably benign Het
Cdadc1 T C 14: 59,586,072 M324V possibly damaging Het
Col12a1 A T 9: 79,700,265 V427D probably damaging Het
Col3a1 C A 1: 45,335,779 probably benign Het
Esp24 A T 17: 39,040,003 E31D possibly damaging Het
Igkv14-100 T A 6: 68,519,351 L76* probably null Het
Itsn2 T C 12: 4,658,474 V843A probably benign Het
Llgl2 T C 11: 115,851,120 S663P probably benign Het
Lsg1 T C 16: 30,561,729 N630S probably damaging Het
Msh4 A G 3: 153,905,860 V42A probably benign Het
Nkx6-1 T C 5: 101,659,535 Y327C probably damaging Het
Pde4a T C 9: 21,203,243 S369P probably damaging Het
Pkdrej T C 15: 85,819,936 I600V probably benign Het
Plekhg6 T C 6: 125,370,469 E479G probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rgmb A T 17: 15,821,090 D78E probably damaging Het
Samd12 C T 15: 53,860,196 E34K probably damaging Het
Slc22a21 T G 11: 53,959,369 E220A probably damaging Het
Smc6 A G 12: 11,289,981 E430G probably damaging Het
Snx15 C A 19: 6,121,485 L186F probably damaging Het
Tiam2 A G 17: 3,518,250 E1557G probably benign Het
Vwa8 A T 14: 78,995,149 T644S probably benign Het
Zcchc4 T A 5: 52,804,438 F247Y probably damaging Het
Zmynd11 A G 13: 9,695,822 V165A probably damaging Het
Other mutations in Olfr1505
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Olfr1505 APN 19 13919528 nonsense probably null
IGL03388:Olfr1505 APN 19 13919620 missense probably damaging 0.99
R0143:Olfr1505 UTSW 19 13919250 missense probably damaging 1.00
R0326:Olfr1505 UTSW 19 13919509 missense probably benign 0.13
R0602:Olfr1505 UTSW 19 13919781 missense probably benign 0.13
R0624:Olfr1505 UTSW 19 13919444 missense probably damaging 0.99
R0947:Olfr1505 UTSW 19 13919171 missense probably benign 0.00
R1472:Olfr1505 UTSW 19 13919844 missense probably damaging 1.00
R1691:Olfr1505 UTSW 19 13919419 missense probably benign 0.00
R4296:Olfr1505 UTSW 19 13919353 missense probably damaging 1.00
R4688:Olfr1505 UTSW 19 13919241 missense probably benign 0.01
R4814:Olfr1505 UTSW 19 13919453 missense possibly damaging 0.50
R4823:Olfr1505 UTSW 19 13919658 missense probably benign 0.02
R5038:Olfr1505 UTSW 19 13919458 missense possibly damaging 0.58
R5243:Olfr1505 UTSW 19 13919661 missense probably damaging 1.00
R5323:Olfr1505 UTSW 19 13919616 missense possibly damaging 0.95
R5542:Olfr1505 UTSW 19 13919047 missense probably benign 0.04
R5918:Olfr1505 UTSW 19 13919775 missense probably damaging 1.00
R6011:Olfr1505 UTSW 19 13919157 missense probably benign 0.00
R6159:Olfr1505 UTSW 19 13919740 missense probably damaging 1.00
R7535:Olfr1505 UTSW 19 13919085 missense probably benign
R8262:Olfr1505 UTSW 19 13919862 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGGCTTTAATGACCACCCCAAG -3'
(R):5'- AGAAGGTGCATGTGGTACGC -3'

Sequencing Primer
(F):5'- TTGTCACCATGCTGGGAAAC -3'
(R):5'- TGGTACGCAGAATGGCCC -3'
Posted On2015-01-11