Incidental Mutation 'R2992:Olfr1158'
ID257931
Institutional Source Beutler Lab
Gene Symbol Olfr1158
Ensembl Gene ENSMUSG00000062793
Gene Nameolfactory receptor 1158
SynonymsMOR173-3, GA_x6K02T2Q125-49480812-49481753
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2992 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87990113-87991054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87990777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000099682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102622]
Predicted Effect probably benign
Transcript: ENSMUST00000102622
AA Change: V222A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099682
Gene: ENSMUSG00000062793
AA Change: V222A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-45 PFAM
Pfam:7tm_1 41 289 4.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baat A T 4: 49,499,675 Y210* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 T A 9: 15,332,747 K1471I probably damaging Het
Cpne4 A T 9: 105,022,365 I416F probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Isg20 C T 7: 78,919,884 A201V probably benign Het
Kdm6b ACTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTG 11: 69,406,307 probably benign Het
Mmp16 G T 4: 18,011,657 G191C probably damaging Het
Olfr611 C T 7: 103,517,770 V205M probably damaging Het
Olfr769 C A 10: 129,111,535 E297* probably null Het
Patl2 T C 2: 122,125,754 S210G probably damaging Het
Plekha6 T C 1: 133,294,658 I994T probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rhobtb2 A G 14: 69,798,323 S100P probably damaging Het
Snx13 T C 12: 35,105,191 L418P probably damaging Het
Spink5 A C 18: 43,996,629 E429A probably damaging Het
Other mutations in Olfr1158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1158 APN 2 87990438 missense probably damaging 1.00
IGL01287:Olfr1158 APN 2 87990944 missense probably benign 0.01
IGL01374:Olfr1158 APN 2 87990548 missense probably benign
IGL01821:Olfr1158 APN 2 87990589 missense probably benign 0.12
IGL01832:Olfr1158 APN 2 87990169 missense probably benign 0.02
IGL02327:Olfr1158 APN 2 87990257 missense probably damaging 1.00
IGL02580:Olfr1158 APN 2 87990513 missense probably benign 0.09
IGL03001:Olfr1158 APN 2 87990149 missense probably benign 0.43
IGL03196:Olfr1158 APN 2 87990482 missense possibly damaging 0.67
R0546:Olfr1158 UTSW 2 87990472 nonsense probably null
R1474:Olfr1158 UTSW 2 87990990 missense probably damaging 1.00
R1650:Olfr1158 UTSW 2 87990801 missense probably benign 0.01
R1757:Olfr1158 UTSW 2 87990582 missense probably damaging 0.99
R4038:Olfr1158 UTSW 2 87990918 missense possibly damaging 0.88
R5190:Olfr1158 UTSW 2 87990763 nonsense probably null
R5871:Olfr1158 UTSW 2 87991011 missense possibly damaging 0.82
R8220:Olfr1158 UTSW 2 87990152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGCATTCTTGGGTGGAAC -3'
(R):5'- CTGTATATCAAGGGGTTAAGCATGG -3'

Sequencing Primer
(F):5'- AAGCATTCTTGGGTGGAACTATGAG -3'
(R):5'- TCAAGGGGTTAAGCATGGGTATAATC -3'
Posted On2015-01-11