Incidental Mutation 'R2992:Patl2'
ID257932
Institutional Source Beutler Lab
Gene Symbol Patl2
Ensembl Gene ENSMUSG00000027233
Gene Nameprotein associated with topoisomerase II homolog 2 (yeast)
SynonymsPat1a, 4930424G05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2992 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122120108-122186189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122125754 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 210 (S210G)
Ref Sequence ENSEMBL: ENSMUSP00000028665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665]
Predicted Effect probably damaging
Transcript: ENSMUST00000028665
AA Change: S210G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: S210G

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baat A T 4: 49,499,675 Y210* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 T A 9: 15,332,747 K1471I probably damaging Het
Cpne4 A T 9: 105,022,365 I416F probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Isg20 C T 7: 78,919,884 A201V probably benign Het
Kdm6b ACTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTG 11: 69,406,307 probably benign Het
Mmp16 G T 4: 18,011,657 G191C probably damaging Het
Olfr1158 T C 2: 87,990,777 V222A probably benign Het
Olfr611 C T 7: 103,517,770 V205M probably damaging Het
Olfr769 C A 10: 129,111,535 E297* probably null Het
Plekha6 T C 1: 133,294,658 I994T probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rhobtb2 A G 14: 69,798,323 S100P probably damaging Het
Snx13 T C 12: 35,105,191 L418P probably damaging Het
Spink5 A C 18: 43,996,629 E429A probably damaging Het
Other mutations in Patl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Patl2 APN 2 122123810 missense probably benign 0.19
IGL01780:Patl2 APN 2 122121846 missense probably damaging 1.00
IGL02604:Patl2 APN 2 122125333 missense possibly damaging 0.80
IGL02713:Patl2 APN 2 122125847 missense probably benign 0.01
IGL02990:Patl2 APN 2 122124497 critical splice acceptor site probably null
FR4304:Patl2 UTSW 2 122126135 small insertion probably benign
FR4548:Patl2 UTSW 2 122126135 small insertion probably benign
FR4737:Patl2 UTSW 2 122126136 small insertion probably benign
FR4737:Patl2 UTSW 2 122126144 nonsense probably null
FR4737:Patl2 UTSW 2 122126145 small insertion probably benign
FR4976:Patl2 UTSW 2 122126139 small insertion probably benign
FR4976:Patl2 UTSW 2 122126141 small insertion probably benign
FR4976:Patl2 UTSW 2 122126144 small insertion probably benign
FR4976:Patl2 UTSW 2 122126145 small insertion probably benign
R0001:Patl2 UTSW 2 122125710 splice site probably benign
R0002:Patl2 UTSW 2 122125710 splice site probably benign
R0540:Patl2 UTSW 2 122126669 missense probably benign
R0570:Patl2 UTSW 2 122125308 missense probably damaging 0.99
R0607:Patl2 UTSW 2 122126669 missense probably benign
R1463:Patl2 UTSW 2 122123735 missense probably benign 0.38
R4329:Patl2 UTSW 2 122127537 missense probably benign 0.01
R4583:Patl2 UTSW 2 122126745 missense probably benign 0.00
R4737:Patl2 UTSW 2 122125306 missense probably damaging 1.00
R4965:Patl2 UTSW 2 122128848 nonsense probably null
R5091:Patl2 UTSW 2 122123802 missense probably benign 0.01
R5256:Patl2 UTSW 2 122128887 missense probably damaging 1.00
R5450:Patl2 UTSW 2 122125281 missense probably benign 0.00
R5990:Patl2 UTSW 2 122124484 missense probably damaging 1.00
R6028:Patl2 UTSW 2 122126137 missense possibly damaging 0.76
R6107:Patl2 UTSW 2 122127486 missense probably damaging 0.98
R6597:Patl2 UTSW 2 122186164 start gained probably benign
R6969:Patl2 UTSW 2 122128929 missense possibly damaging 0.52
R7131:Patl2 UTSW 2 122121782 critical splice donor site probably null
R7436:Patl2 UTSW 2 122127525 missense probably benign 0.00
R7852:Patl2 UTSW 2 122179109 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTACAAGGGAAGGATCTTGGGATAC -3'
(R):5'- CAACACTGCACCTGTTCCAG -3'

Sequencing Primer
(F):5'- CTAAACAGATGTGGCCTC -3'
(R):5'- AGTCCTTTCAAGAGCACTCCACTG -3'
Posted On2015-01-11