Mutagenetix > Incidental Mutations

Incidental Mutation 'R2992:Patl2'

257932

Institutional Source

Beutler Lab

Gene Symbol

Patl2

Ensembl Gene

ENSMUSG00000027233

Gene Name

protein associated with topoisomerase II homolog 2 (yeast)

Synonyms

Pat1a, 4930424G05Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R2992 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122120108-122186189 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122125754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 210 (S210G)

Ref Sequence

ENSEMBL: ENSMUSP00000028665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028665]

AlphaFold

A2ARM1

Predicted Effect

probably damaging
Transcript: ENSMUST00000028665
AA Change: S210G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233
AA Change: S210G

Domain	Start	End	E-Value	Type
low complexity region	33	41	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
low complexity region	215	227	N/A	INTRINSIC
Pfam:PAT1	247	490	6.7e-12	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Baat	A	T	4: 49,499,675	Y210*	probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cep295	T	A	9: 15,332,747	K1471I	probably damaging	Het
Cpne4	A	T	9: 105,022,365	I416F	probably damaging	Het
Cul7	C	G	17: 46,651,600	D52E	probably benign	Het
Isg20	C	T	7: 78,919,884	A201V	probably benign	Het
Kdm6b	ACTGCTGCTGCTGCTGCTGCTGCTG	ACTGCTGCTGCTGCTGCTGCTG	11: 69,406,307		probably benign	Het
Mmp16	G	T	4: 18,011,657	G191C	probably damaging	Het
Olfr1158	T	C	2: 87,990,777	V222A	probably benign	Het
Olfr611	C	T	7: 103,517,770	V205M	probably damaging	Het
Olfr769	C	A	10: 129,111,535	E297*	probably null	Het
Plekha6	T	C	1: 133,294,658	I994T	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rhobtb2	A	G	14: 69,798,323	S100P	probably damaging	Het
Snx13	T	C	12: 35,105,191	L418P	probably damaging	Het
Spink5	A	C	18: 43,996,629	E429A	probably damaging	Het

Other mutations in Patl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01293:Patl2	APN	2	122123810	missense	probably benign	0.19
IGL01780:Patl2	APN	2	122121846	missense	probably damaging	1.00
IGL02604:Patl2	APN	2	122125333	missense	possibly damaging	0.80
IGL02713:Patl2	APN	2	122125847	missense	probably benign	0.01
IGL02990:Patl2	APN	2	122124497	critical splice acceptor site	probably null
FR4304:Patl2	UTSW	2	122126135	small insertion	probably benign
FR4548:Patl2	UTSW	2	122126135	small insertion	probably benign
FR4737:Patl2	UTSW	2	122126136	small insertion	probably benign
FR4737:Patl2	UTSW	2	122126144	nonsense	probably null
FR4737:Patl2	UTSW	2	122126145	small insertion	probably benign
FR4976:Patl2	UTSW	2	122126139	small insertion	probably benign
FR4976:Patl2	UTSW	2	122126141	small insertion	probably benign
FR4976:Patl2	UTSW	2	122126144	small insertion	probably benign
FR4976:Patl2	UTSW	2	122126145	small insertion	probably benign
R0001:Patl2	UTSW	2	122125710	splice site	probably benign
R0002:Patl2	UTSW	2	122125710	splice site	probably benign
R0540:Patl2	UTSW	2	122126669	missense	probably benign
R0570:Patl2	UTSW	2	122125308	missense	probably damaging	0.99
R0607:Patl2	UTSW	2	122126669	missense	probably benign
R1463:Patl2	UTSW	2	122123735	missense	probably benign	0.38
R4329:Patl2	UTSW	2	122127537	missense	probably benign	0.01
R4583:Patl2	UTSW	2	122126745	missense	probably benign	0.00
R4737:Patl2	UTSW	2	122125306	missense	probably damaging	1.00
R4965:Patl2	UTSW	2	122128848	nonsense	probably null
R5091:Patl2	UTSW	2	122123802	missense	probably benign	0.01
R5256:Patl2	UTSW	2	122128887	missense	probably damaging	1.00
R5450:Patl2	UTSW	2	122125281	missense	probably benign	0.00
R5990:Patl2	UTSW	2	122124484	missense	probably damaging	1.00
R6028:Patl2	UTSW	2	122126137	missense	possibly damaging	0.76
R6107:Patl2	UTSW	2	122127486	missense	probably damaging	0.98
R6597:Patl2	UTSW	2	122186164	start gained	probably benign
R6969:Patl2	UTSW	2	122128929	missense	possibly damaging	0.52
R7131:Patl2	UTSW	2	122121782	critical splice donor site	probably null
R7436:Patl2	UTSW	2	122127525	missense	probably benign	0.00
R7718:Patl2	UTSW	2	122126774	splice site	probably null
R7852:Patl2	UTSW	2	122179109	unclassified	probably benign
R8397:Patl2	UTSW	2	122125273	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTACAAGGGAAGGATCTTGGGATAC -3'
(R):5'- CAACACTGCACCTGTTCCAG -3'

Sequencing Primer
(F):5'- CTAAACAGATGTGGCCTC -3'
(R):5'- AGTCCTTTCAAGAGCACTCCACTG -3'

Posted On

2015-01-11