Incidental Mutation 'R2992:Cpne4'
ID257940
Institutional Source Beutler Lab
Gene Symbol Cpne4
Ensembl Gene ENSMUSG00000032564
Gene Namecopine IV
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2992 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location104547286-105034544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105022365 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 416 (I416F)
Ref Sequence ENSEMBL: ENSMUSP00000049663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057742] [ENSMUST00000077190] [ENSMUST00000213452]
Predicted Effect probably damaging
Transcript: ENSMUST00000057742
AA Change: I416F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049663
Gene: ENSMUSG00000032564
AA Change: I416F

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 261 4.22e-5 SMART
low complexity region 269 279 N/A INTRINSIC
VWA 305 507 2.61e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000077190
AA Change: I334F
SMART Domains Protein: ENSMUSP00000076432
Gene: ENSMUSG00000032564
AA Change: I334F

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 275 1.94e1 SMART
VWA 223 425 9.73e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000213452
AA Change: I167F
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the highly conserved copine family. It encodes a calcium-dependent, phospholipid-binding protein, which may be involved in membrane trafficking, mitogenesis and development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Baat A T 4: 49,499,675 Y210* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 T A 9: 15,332,747 K1471I probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Isg20 C T 7: 78,919,884 A201V probably benign Het
Kdm6b ACTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTG 11: 69,406,307 probably benign Het
Mmp16 G T 4: 18,011,657 G191C probably damaging Het
Olfr1158 T C 2: 87,990,777 V222A probably benign Het
Olfr611 C T 7: 103,517,770 V205M probably damaging Het
Olfr769 C A 10: 129,111,535 E297* probably null Het
Patl2 T C 2: 122,125,754 S210G probably damaging Het
Plekha6 T C 1: 133,294,658 I994T probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rhobtb2 A G 14: 69,798,323 S100P probably damaging Het
Snx13 T C 12: 35,105,191 L418P probably damaging Het
Spink5 A C 18: 43,996,629 E429A probably damaging Het
Other mutations in Cpne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Cpne4 APN 9 104901511 missense probably damaging 1.00
IGL01871:Cpne4 APN 9 104925757 missense possibly damaging 0.93
IGL02097:Cpne4 APN 9 104686502 missense probably damaging 1.00
IGL02698:Cpne4 APN 9 105032785 missense probably damaging 1.00
IGL02933:Cpne4 APN 9 105019767 missense possibly damaging 0.64
R0471:Cpne4 UTSW 9 105022282 splice site probably null
R0528:Cpne4 UTSW 9 104686441 missense probably damaging 0.99
R0698:Cpne4 UTSW 9 104925795 missense probably damaging 1.00
R1025:Cpne4 UTSW 9 104993858 missense possibly damaging 0.64
R1054:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R1300:Cpne4 UTSW 9 104993134 missense probably damaging 1.00
R1422:Cpne4 UTSW 9 104900285 missense probably damaging 0.98
R1439:Cpne4 UTSW 9 104989632 missense probably damaging 0.99
R1634:Cpne4 UTSW 9 104989579 missense possibly damaging 0.94
R1777:Cpne4 UTSW 9 104872688 missense probably damaging 1.00
R4094:Cpne4 UTSW 9 104686535 missense probably damaging 1.00
R4729:Cpne4 UTSW 9 104922556 missense probably damaging 0.96
R4943:Cpne4 UTSW 9 105019773 missense probably damaging 1.00
R5119:Cpne4 UTSW 9 104901521 splice site probably null
R5787:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R5839:Cpne4 UTSW 9 104925828 missense probably damaging 1.00
R5876:Cpne4 UTSW 9 104925770 missense probably damaging 0.98
R7386:Cpne4 UTSW 9 104872740 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTCTTGAGATCCTACAAGTGG -3'
(R):5'- GTGTCCACCCTAAGCTTCAC -3'

Sequencing Primer
(F):5'- CTATCTGGAGAAAGTTAATGTGTTGC -3'
(R):5'- TCCTCCAATAAAGAGACTGTGAAG -3'
Posted On2015-01-11